Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AKT2 cdna clone

AKT2 cDNA Clone

Gene Names
AKT2; PKBB; PRKBB; HIHGHH; PKBBETA; RAC-BETA
Synonyms
AKT2; AKT2 cDNA Clone; AKT2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggtgtctgtcatcaaagaaggctggctccacaagcgtggtgaaatacatcaagacctggaggccacggtacttcctgctgaagagcgacggctccttcattgggtacaaggagaggcccgaggcccctgatcagactctaccccccttaaacaacttctccgtagcagaatgccagctgatgaagaccgagaggccgcgacccaacacctttgtcatacgctgcctgcagtggaccacagtcatcgagaggaccttccacgtggattctccagacgagagggaggagtggatgcgggccatccagatggtcgccaacagcctccagcctcacctttgtgcccagactcgcatttggaagactccacctcccgcccaggcctgggctgttgggcggttggagattcaggttttaatccacacaagccccagtgaggggtga
Sequence Length
444
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
208
Molecular Weight
51,083 Da
NCBI Official Full Name
Homo sapiens v-akt murine thymoma viral oncogene homolog 2, mRNA
NCBI Official Synonym Full Names
AKT serine/threonine kinase 2
NCBI Official Symbol
AKT2
NCBI Official Synonym Symbols
PKBB; PRKBB; HIHGHH; PKBBETA; RAC-BETA
NCBI Protein Information
RAC-beta serine/threonine-protein kinase
UniProt Protein Name
RAC-beta serine/threonine-protein kinase
Protein Family
UniProt Gene Name
AKT2
UniProt Synonym Gene Names
PKB beta
UniProt Entry Name
AKT2_HUMAN

NCBI Description

This gene is a putative oncogene encoding a protein belonging to a subfamily of serine/threonine kinases containing SH2-like (Src homology 2-like) domains. The gene was shown to be amplified and overexpressed in 2 of 8 ovarian carcinoma cell lines and 2 of 15 primary ovarian tumors. Overexpression contributes to the malignant phenotype of a subset of human ductal pancreatic cancers. The encoded protein is a general protein kinase capable of phophorylating several known proteins. [provided by RefSeq, Jul 2008]

Uniprot Description

AKT2 is one of 3 closely related serine/threonine-protein kinases (AKT1, AKT2 and AKT3) called the AKT kinase, and which regulate many processes including metabolism, proliferation, cell survival, growth and angiogenesis. This is mediated through serine and/or threonine phosphorylation of a range of downstream substrates. Over 100 substrate candidates have been reported so far, but for most of them, no isoform specificity has been reported. AKT is responsible of the regulation of glucose uptake by mediating insulin-induced translocation of the SLC2A4/GLUT4 glucose transporter to the cell surface. Phosphorylation of PTPN1 at 'Ser-50' negatively modulates its phosphatase activity preventing dephosphorylation of the insulin receptor and the attenuation of insulin signaling. Phosphorylation of TBC1D4 triggers the binding of this effector to inhibitory 14-3-3 proteins, which is required for insulin-stimulated glucose transport. AKT regulates also the storage of glucose in the form of glycogen by phosphorylating GSK3A at 'Ser-21' and GSK3B at 'Ser-9', resulting in inhibition of its kinase activity. Phosphorylation of GSK3 isoforms by AKT is also thought to be one mechanism by which cell proliferation is driven. AKT regulates also cell survival via the phosphorylation of MAP3K5 (apoptosis signal-related kinase). Phosphorylation of 'Ser-83' decreases MAP3K5 kinase activity stimulated by oxidative stress and thereby prevents apoptosis. AKT mediates insulin-stimulated protein synthesis by phosphorylating TSC2 at 'Ser-939' and 'Thr-1462', thereby activating mTORC1 signaling and leading to both phosphorylation of 4E-BP1 and in activation of RPS6KB1. AKT is involved in the phosphorylation of members of the FOXO factors (Forkhead family of transcription factors), leading to binding of 14-3-3 proteins and cytoplasmic localization. In particular, FOXO1 is phosphorylated at 'Thr-24', 'Ser-256' and 'Ser-319'. FOXO3 and FOXO4 are phosphorylated on equivalent sites. AKT has an important role in the regulation of NF-kappa-B-dependent gene transcription and positively regulates the activity of CREB1 (cyclic AMP (cAMP)-response element binding protein). The phosphorylation of CREB1 induces the binding of accessory proteins that are necessary for the transcription of pro-survival genes such as BCL2 and MCL1. AKT phosphorylates 'Ser-454' on ATP citrate lyase (ACLY), thereby potentially regulating ACLY activity and fatty acid synthesis. Activates the 3B isoform of cyclic nucleotide phosphodiesterase (PDE3B) via phosphorylation of 'Ser-273', resulting in reduced cyclic AMP levels and inhibition of lipolysis. Phosphorylates PIKFYVE on 'Ser-318', which results in increased PI3P-5 activity. The Rho GTPase-activating protein DLC1 is another substrate and its phosphorylation is implicated in the regulation cell proliferation and cell growth. AKT plays a role as key modulator of the AKT-mTOR signaling pathway controlling the tempo of the process of newborn neurons integration during adult neurogenesis, including correct neuron positioning, dendritic development and synapse formation. Signals downstream of phosphatidylinositol 3-kinase (PI3K) to mediate the effects of various growth factors such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), insulin and insulin-like growth factor I (IGF-I). AKT mediates the antiapoptotic effects of IGF-I. Essential for the SPATA13-mediated regulation of cell migration and adhesion assembly and disassembly. May be involved in the regulation of the placental development.

Research Articles on AKT2

Similar Products

Product Notes

The AKT2 akt2 (Catalog #AAA1269707) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggtgtc tgtcatcaaa gaaggctggc tccacaagcg tggtgaaata catcaagacc tggaggccac ggtacttcct gctgaagagc gacggctcct tcattgggta caaggagagg cccgaggccc ctgatcagac tctacccccc ttaaacaact tctccgtagc agaatgccag ctgatgaaga ccgagaggcc gcgacccaac acctttgtca tacgctgcct gcagtggacc acagtcatcg agaggacctt ccacgtggat tctccagacg agagggagga gtggatgcgg gccatccaga tggtcgccaa cagcctccag cctcaccttt gtgcccagac tcgcatttgg aagactccac ctcccgccca ggcctgggct gttgggcggt tggagattca ggttttaatc cacacaagcc ccagtgaggg gtga. It is sometimes possible for the material contained within the vial of "AKT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.