CPVL cdna clone
CPVL cDNA Clone
Gene Names
CPVL; HVLP
Synonyms
CPVL; CPVL cDNA Clone; CPVL cdna clone
Sequence
atggttggtgccatgtggaaggtgattgtttcgctggtcctgttgatgcctggcccctgtgatgggctgtttcgctccctatacagaagtgtttccatgccacctaagggagactcaggacagccattatttctcaccccttacattgaagctgggaagatccaaaaaggaagagaattgagtttggtcggccctttcccaggactgaacatgaagagttatgccggcttcctcaccgtgaataagacttacaacagcaacctcttcttctggttcttcccagctcagatacagccagaagatgccccagtagttctctggctacagggtgggccgggaggttcatccatgtttggactctttgtggaacatgggccttatgttgtcacaagtaacatgaccttgcgtgacagagacttcccctggaccacaacgctctccatgctttacattgacaatccagtgggcacaggcttcagttttactgatgatacccacggatatgcagtcaatgaggacgatgtagcacgggatttatacagtgcactaattcagtttttccagatatttcctgaatataaaaataatgacttttatgtcactggggagtcttatgcagggaaatatgtgccagccattgcacacctcatccattccctcaaccctgtgagagaggtgaagatcaacctgaacggaattgctattggagatggatattctgatcccgaatcaattatagggggctatgcagaattcctgtaccaaattggcttgttggatgagaagcaaaaaaagtacttccagaagcagtgccatgaatgcatagaacacatcaggaagcagaactggtttgaggcctttgaaatactggataaactactagatggcgacttaacaagtgatccttcttacttccagaatgttacaggatgtagtaattactataactttttgcggtgcacggaacctgaggatcagctttactatgtgaaatttttgtcactcccagaggtgagacaagccatccacgtggggaatcagacttttaatgatggaactatagttgaaaagtacttgcgagaagatacagtacagtcagttaagccatggttaactgaaatcatgaataattataaggttctgatctacaatggccaactggacatcatcgtggcagctgccctgacagagcgctccttgatgggcatggactggaaaggatcccaggaatacaagaaggcagaaaaaaaagtttggaagatctttaaatctgacagtgaagtggctggttacatccggcaagtgggtgacttccatcaggtaattattcgaggtggaggacatattttaccctatgaccagcctctgagagcttttgacatgattaatcgattcatttatggaaaaggatgggatccttatgttggataa
Sequence Length
1431
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
54,164 Da
NCBI Official Full Name
Homo sapiens carboxypeptidase, vitellogenic-like, mRNA
NCBI Official Synonym Full Names
carboxypeptidase, vitellogenic like
NCBI Official Symbol
CPVL
NCBI Official Synonym Symbols
HVLP
NCBI Protein Information
probable serine carboxypeptidase CPVL
UniProt Protein Name
Probable serine carboxypeptidase CPVL
Protein Family
UniProt Gene Name
CPVL
UniProt Synonym Gene Names
VLP; VCP-like protein; hVLP
UniProt Entry Name
CPVL_HUMAN
NCBI Description
The protein encoded by this gene is a carboxypeptidase and bears strong sequence similarity to serine carboxypeptidases. Carboxypeptidases are a large class of proteases that act to cleave a single amino acid from the carboxy termini of proteins or peptides. The exact function of this protein, however, has not been determined. At least two alternatively spliced transcripts which encode the same protein have been observed. [provided by RefSeq, Jul 2008]
Uniprot Description
CPVL: May be involved in the digestion of phagocytosed particles in the lysosome, participation in an inflammatory protease cascade, and trimming of peptides for antigen presentation. Belongs to the peptidase S10 family.
Protein type: Secreted, signal peptide; Protease; Secreted; EC 3.4.16.-
Chromosomal Location of Human Ortholog: 7p15.1
Molecular Function: serine carboxypeptidase activity
Biological Process: proteolysis involved in cellular protein catabolic process
Research Articles on CPVL
Similar Products
Product Notes
The CPVL cpvl (Catalog #AAA1269679) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttggtg ccatgtggaa ggtgattgtt tcgctggtcc tgttgatgcc tggcccctgt gatgggctgt ttcgctccct atacagaagt gtttccatgc cacctaaggg agactcagga cagccattat ttctcacccc ttacattgaa gctgggaaga tccaaaaagg aagagaattg agtttggtcg gccctttccc aggactgaac atgaagagtt atgccggctt cctcaccgtg aataagactt acaacagcaa cctcttcttc tggttcttcc cagctcagat acagccagaa gatgccccag tagttctctg gctacagggt gggccgggag gttcatccat gtttggactc tttgtggaac atgggcctta tgttgtcaca agtaacatga ccttgcgtga cagagacttc ccctggacca caacgctctc catgctttac attgacaatc cagtgggcac aggcttcagt tttactgatg atacccacgg atatgcagtc aatgaggacg atgtagcacg ggatttatac agtgcactaa ttcagttttt ccagatattt cctgaatata aaaataatga cttttatgtc actggggagt cttatgcagg gaaatatgtg ccagccattg cacacctcat ccattccctc aaccctgtga gagaggtgaa gatcaacctg aacggaattg ctattggaga tggatattct gatcccgaat caattatagg gggctatgca gaattcctgt accaaattgg cttgttggat gagaagcaaa aaaagtactt ccagaagcag tgccatgaat gcatagaaca catcaggaag cagaactggt ttgaggcctt tgaaatactg gataaactac tagatggcga cttaacaagt gatccttctt acttccagaa tgttacagga tgtagtaatt actataactt tttgcggtgc acggaacctg aggatcagct ttactatgtg aaatttttgt cactcccaga ggtgagacaa gccatccacg tggggaatca gacttttaat gatggaacta tagttgaaaa gtacttgcga gaagatacag tacagtcagt taagccatgg ttaactgaaa tcatgaataa ttataaggtt ctgatctaca atggccaact ggacatcatc gtggcagctg ccctgacaga gcgctccttg atgggcatgg actggaaagg atcccaggaa tacaagaagg cagaaaaaaa agtttggaag atctttaaat ctgacagtga agtggctggt tacatccggc aagtgggtga cttccatcag gtaattattc gaggtggagg acatatttta ccctatgacc agcctctgag agcttttgac atgattaatc gattcattta tggaaaagga tgggatcctt atgttggata a. It is sometimes possible for the material contained within the vial of "CPVL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
