Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDR25 cdna clone

WDR25 cDNA Clone

Gene Names
WDR25; C14orf67
Synonyms
WDR25; WDR25 cDNA Clone; WDR25 cdna clone
Ordering
For Research Use Only!
Sequence
atgccagctctgtgcctggtgctgtgctggtttcaagggctgttgggagaggtatggaacgccgtggactccgggcactgcctgcagacctactccctgcacacagaggcagtgcgggccgcccggtgggctccctgtggccggcgcatcctcagtggtggctttgacttcgcgctgcacctaacagaccttgaaacaggaacccagctatttagtggtcgaagtgactttagaatcactaccttgaaattccatccaaaagaccacaacatctttttatgtggaggcttcagctctgaaatgaaagcttgggatataaggactggcaaggtgatgagaagctacaaggcgaccatccagcagaccttggacatcctgttcctccgggaaggctccgagttcctgagcagcacagacgcttccacccgggactcagctgaccgcaccattattgcctgggatttccggacctctgccaaaatctccaaccagattttccacgagaggttcacctgccccagcctcgccttgcacccgagagagcccgtgttcctggcacagaccaatggcaactacctggcccttttctccactgtgtggccctaccggatgagcagacggcggcgctatgaagggcacaaggtggagggctactcagtgggctgcgagtgctccccaggcggtgacttgctggtgacgggcagcgccgatggccgggtcctgatgtacagcttccgcacagccagccgagcatgcacactgcaggggcacacacaggcctgtgtcggcaccacctaccaccccgtgctgccctccgtcctcgccacctgctcctggggaggggacatgaagatctggcactga
Sequence Length
864
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,166 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 25, mRNA
NCBI Official Synonym Full Names
WD repeat domain 25
NCBI Official Symbol
WDR25
NCBI Official Synonym Symbols
C14orf67
NCBI Protein Information
WD repeat-containing protein 25
UniProt Protein Name
WD repeat-containing protein 25
UniProt Gene Name
WDR25
UniProt Entry Name
WDR25_HUMAN

Uniprot Description

WDR25: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 14q32.2

Molecular Function: protein binding

Similar Products

Product Notes

The WDR25 wdr25 (Catalog #AAA1269628) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccagctc tgtgcctggt gctgtgctgg tttcaagggc tgttgggaga ggtatggaac gccgtggact ccgggcactg cctgcagacc tactccctgc acacagaggc agtgcgggcc gcccggtggg ctccctgtgg ccggcgcatc ctcagtggtg gctttgactt cgcgctgcac ctaacagacc ttgaaacagg aacccagcta tttagtggtc gaagtgactt tagaatcact accttgaaat tccatccaaa agaccacaac atctttttat gtggaggctt cagctctgaa atgaaagctt gggatataag gactggcaag gtgatgagaa gctacaaggc gaccatccag cagaccttgg acatcctgtt cctccgggaa ggctccgagt tcctgagcag cacagacgct tccacccggg actcagctga ccgcaccatt attgcctggg atttccggac ctctgccaaa atctccaacc agattttcca cgagaggttc acctgcccca gcctcgcctt gcacccgaga gagcccgtgt tcctggcaca gaccaatggc aactacctgg cccttttctc cactgtgtgg ccctaccgga tgagcagacg gcggcgctat gaagggcaca aggtggaggg ctactcagtg ggctgcgagt gctccccagg cggtgacttg ctggtgacgg gcagcgccga tggccgggtc ctgatgtaca gcttccgcac agccagccga gcatgcacac tgcaggggca cacacaggcc tgtgtcggca ccacctacca ccccgtgctg ccctccgtcc tcgccacctg ctcctgggga ggggacatga agatctggca ctga. It is sometimes possible for the material contained within the vial of "WDR25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.