GGA2 cdna clone
GGA2 cDNA Clone
Gene Names
GGA2; VEAR
Synonyms
GGA2; GGA2 cDNA Clone; GGA2 cdna clone
Sequence
atggcggcgaccgcggtggcggcggctgtggcgggaaccgagtcggcccagggtcccccgggcccggcagcgtcgctggagctgtggctgaacaaagccacagacccaagcatgtcggaacaggattggtcagctatccagaatttctgtgagcaggtgaacactgaccccaatggccccacacatgcgccctggctactggcccacaagatccagtctccgcaagagaaggaagctctttatgccttaacggtgctggagatgtgcatgaaccactgtggggagaagttccacagcgaggtggccaaatttcgtttcctgaacgaactgatcaaagtgttgtccccaaagtacctggggtcctgggccacaggaaaagttaaaggaagagtcattgaaatactcttcagttggacagtctggtttccggaagacatcaagattcgagacgcttatcagatgctgaagaaacaaggaattataaaacaagaccctaaactaccagtggataaaatcttacccccaccatctccctggcccaagagctccatctttgatgctgatgaagaaaagtccaagcttctgacaaggcttctaaagagcaaccaccccgaggaccttcaggctgcaaaccggttaatcaagaatttggtcaaggaggaacaagaaaaatcggagaaggtgtccaagagggtcagtgcggtggaggaagtgcgaagccatgtgaaggtgctgcaggagatgctgagcatgtaccgcaggccagggcaggccccgcccgaccaggaggccctgcaggtcgtgtatgagaggtgtgaaaagctgcggcccacgctgttccggttggcgagtgacaccactgatgacgatgatgcactcgcggaaattctccaggcaaatgacctcctcacccaaggagttctgctgtacaaacaggtgatggagggccgggtcacctttggaaacagagtgaccagctcattgggagacatccctgtctccagagtctttcagaatccagcaggctgcatgaagacctgccccctgattgacttggaggtggacaatggacctgcgcagatggggactgtggtgccatctttgcttcatcaggacctggcagccttgggaatcagtgatgctcctgttacaggcatggtttctggtcagaattgctgtgaggaaaagaggaatccctcctccagcacgctgccaggcggtggtgttcagaacccttctgcagacaggaatttgctggacctcctctcaccacagccagctccgtgccctctgaattatgtttcgcagaaaagtgtccccaaggaagtgccaccaggtactaagtcctctccaggttggtcctgggaggctggcccgttggctccttccccatcttcacagaatacacctctggctcaagtgtttgtccctttggagtctgttaagcccagcagcctgccgcctctcattgtgtatgaccggaatggattcagaattctgctccacttctcccagacgggagcccctgggcacccagaggtacaggtgctgctcttgaccatgatgagcacggctccccagcctgtctgggatatcatgtttcaagtggctgtgccaaagtcaatgagagtgaagctgcagccggcatccagctccaagcttcctgcattcagtcctttgatgcctccagctgtgatatctcagatgctgctgcttgacaatccacacaaagaacctatccgcttacggtacaagctgacattcaaccaaggtggacagcctttcagcgaagtaggagaagtgaaagacttcccagacctggctgtcttgggcgcagcctaa
Sequence Length
1842
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
67,150 Da
NCBI Official Full Name
Homo sapiens golgi associated, gamma adaptin ear containing, ARF binding protein 2, mRNA
NCBI Official Synonym Full Names
golgi associated, gamma adaptin ear containing, ARF binding protein 2
NCBI Official Symbol
GGA2
NCBI Official Synonym Symbols
VEAR
NCBI Protein Information
ADP-ribosylation factor-binding protein GGA2
UniProt Protein Name
ADP-ribosylation factor-binding protein GGA2
Protein Family
UniProt Gene Name
GGA2
UniProt Synonym Gene Names
KIAA1080; Vear
UniProt Entry Name
GGA2_HUMAN
NCBI Description
This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. This family member may play a significant role in cargo molecules regulation and clathrin-coated vesicle assembly. [provided by RefSeq, Jul 2008]
Uniprot Description
GGA2: Plays a role in protein sorting and trafficking between the trans-Golgi network (TGN) and endosomes. Mediates the ARF- dependent recruitment of clathrin to the TGN and binds ubiquitinated proteins and membrane cargo molecules with a cytosolic acidic cluster-dileucine (AC-LL) motif. Belongs to the GGA protein family.
Protein type: Vesicle; Adaptor/scaffold
Chromosomal Location of Human Ortholog: 16p12
Cellular Component: clathrin-coated vesicle; endosome membrane; Golgi apparatus; trans-Golgi network
Molecular Function: ADP-ribosylation factor binding; protein binding
Biological Process: cellular protein metabolic process
Research Articles on GGA2
Similar Products
Product Notes
The GGA2 gga2 (Catalog #AAA1269589) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcga ccgcggtggc ggcggctgtg gcgggaaccg agtcggccca gggtcccccg ggcccggcag cgtcgctgga gctgtggctg aacaaagcca cagacccaag catgtcggaa caggattggt cagctatcca gaatttctgt gagcaggtga acactgaccc caatggcccc acacatgcgc cctggctact ggcccacaag atccagtctc cgcaagagaa ggaagctctt tatgccttaa cggtgctgga gatgtgcatg aaccactgtg gggagaagtt ccacagcgag gtggccaaat ttcgtttcct gaacgaactg atcaaagtgt tgtccccaaa gtacctgggg tcctgggcca caggaaaagt taaaggaaga gtcattgaaa tactcttcag ttggacagtc tggtttccgg aagacatcaa gattcgagac gcttatcaga tgctgaagaa acaaggaatt ataaaacaag accctaaact accagtggat aaaatcttac ccccaccatc tccctggccc aagagctcca tctttgatgc tgatgaagaa aagtccaagc ttctgacaag gcttctaaag agcaaccacc ccgaggacct tcaggctgca aaccggttaa tcaagaattt ggtcaaggag gaacaagaaa aatcggagaa ggtgtccaag agggtcagtg cggtggagga agtgcgaagc catgtgaagg tgctgcagga gatgctgagc atgtaccgca ggccagggca ggccccgccc gaccaggagg ccctgcaggt cgtgtatgag aggtgtgaaa agctgcggcc cacgctgttc cggttggcga gtgacaccac tgatgacgat gatgcactcg cggaaattct ccaggcaaat gacctcctca cccaaggagt tctgctgtac aaacaggtga tggagggccg ggtcaccttt ggaaacagag tgaccagctc attgggagac atccctgtct ccagagtctt tcagaatcca gcaggctgca tgaagacctg ccccctgatt gacttggagg tggacaatgg acctgcgcag atggggactg tggtgccatc tttgcttcat caggacctgg cagccttggg aatcagtgat gctcctgtta caggcatggt ttctggtcag aattgctgtg aggaaaagag gaatccctcc tccagcacgc tgccaggcgg tggtgttcag aacccttctg cagacaggaa tttgctggac ctcctctcac cacagccagc tccgtgccct ctgaattatg tttcgcagaa aagtgtcccc aaggaagtgc caccaggtac taagtcctct ccaggttggt cctgggaggc tggcccgttg gctccttccc catcttcaca gaatacacct ctggctcaag tgtttgtccc tttggagtct gttaagccca gcagcctgcc gcctctcatt gtgtatgacc ggaatggatt cagaattctg ctccacttct cccagacggg agcccctggg cacccagagg tacaggtgct gctcttgacc atgatgagca cggctcccca gcctgtctgg gatatcatgt ttcaagtggc tgtgccaaag tcaatgagag tgaagctgca gccggcatcc agctccaagc ttcctgcatt cagtcctttg atgcctccag ctgtgatatc tcagatgctg ctgcttgaca atccacacaa agaacctatc cgcttacggt acaagctgac attcaaccaa ggtggacagc ctttcagcga agtaggagaa gtgaaagact tcccagacct ggctgtcttg ggcgcagcct aa. It is sometimes possible for the material contained within the vial of "GGA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
