KLF15 cdna clone
KLF15 cDNA Clone
Gene Names
KLF15; KKLF
Synonyms
KLF15; KLF15 cDNA Clone; KLF15 cdna clone
Sequence
atggtggaccacttacttccagtggacgagaacttctcgtcgccaaaatgcccagttgggtatctgggtgataggctggttggccggcgggcatatcacatgctgccctcacccgtctctgaagatgacagcgatgcctccagcccctgctcctgttccagtcccgactctcaagccctctgctcctgctatggtggaggcctgggcaccgagagccaggacagcatcttggacttcctattgtcccaggccacgctgggcagtggcgggggcagcggcagtagcattggggccagcagtggccccgtggcctgggggccctggcgaagggcagcggcccctgtgaagggggagcatttctgcttgcccgagtttcctttgggtgatcctgatgacgtcccacggcccttccagcctaccctggaggagattgaagagtttctggaggagaacatggagcctggagtcaaggaggtccctgagggcaacagcaaggacttggatgcctgcagccagctctcagctgggccacacaagagccacctccatcctgggtccagcgggagagagcgctgttcccctccaccaggtggtgccagtgcaggaggtgcccagggcccaggtgggggccccacgcctgatggccccatcccagtgttgctgcagatccagcccgtgcctgtgaagcaggaatcgggcacagggcctgcctcccctgggcaagccccagagaatgtcaaggttgcccagctcctggtcaacatccaggggcagaccttcgcactcgtgccccaggtggtaccctcctccaacttgaacctgccctccaagtttgtgcgcattgcccctgtgcccattgccgccaagcctgttggatcgggacccctggggcctggccctgccggtctcctcatgggccagaagttccccaagaacccagccgcagaactcatcaaaatgcacaaatgtactttccctggctgcagcaagatgtacaccaaaagcagccacctcaaggcccacctgcgccggcacacgggtgagaagcccttcgcctgcacctggccaggctgcggctggaggttctcgcgctctgacgagctgtcgcggcacaggcgctcgcactcaggtgtgaagccgtaccagtgtcctgtgtgcgagaagaagttcgcgcggagcgaccacctctccaagcacatcaaggtgcaccgcttcccgcggagcagccgctccgtgcgctccgtgaactga
Sequence Length
1251
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
43,992 Da
NCBI Official Full Name
Homo sapiens Kruppel-like factor 15, mRNA
NCBI Official Synonym Full Names
Kruppel like factor 15
NCBI Official Symbol
KLF15
NCBI Official Synonym Symbols
KKLF
NCBI Protein Information
Krueppel-like factor 15
UniProt Protein Name
Krueppel-like factor 15
Protein Family
UniProt Gene Name
KLF15
UniProt Synonym Gene Names
KKLF
UniProt Entry Name
KLF15_HUMAN
Uniprot Description
KLF15: Transcriptional activator. Binds to the GA element of the CLCNKA promoter. Belongs to the Sp1 C2H2-type zinc-finger protein family.
Protein type: Transcription factor; DNA-binding; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 3q21.3
Cellular Component: nucleus
Molecular Function: protein binding
Biological Process: positive regulation of transcription from RNA polymerase II promoter
Research Articles on KLF15
1. Case Reports: 2 girls with primary renal myoepithelial carcinomas with a novel EWSR1-KLF15 fusion.
Similar Products
Product Notes
The KLF15 klf15 (Catalog #AAA1269585) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggacc acttacttcc agtggacgag aacttctcgt cgccaaaatg cccagttggg tatctgggtg ataggctggt tggccggcgg gcatatcaca tgctgccctc acccgtctct gaagatgaca gcgatgcctc cagcccctgc tcctgttcca gtcccgactc tcaagccctc tgctcctgct atggtggagg cctgggcacc gagagccagg acagcatctt ggacttccta ttgtcccagg ccacgctggg cagtggcggg ggcagcggca gtagcattgg ggccagcagt ggccccgtgg cctgggggcc ctggcgaagg gcagcggccc ctgtgaaggg ggagcatttc tgcttgcccg agtttccttt gggtgatcct gatgacgtcc cacggccctt ccagcctacc ctggaggaga ttgaagagtt tctggaggag aacatggagc ctggagtcaa ggaggtccct gagggcaaca gcaaggactt ggatgcctgc agccagctct cagctgggcc acacaagagc cacctccatc ctgggtccag cgggagagag cgctgttccc ctccaccagg tggtgccagt gcaggaggtg cccagggccc aggtgggggc cccacgcctg atggccccat cccagtgttg ctgcagatcc agcccgtgcc tgtgaagcag gaatcgggca cagggcctgc ctcccctggg caagccccag agaatgtcaa ggttgcccag ctcctggtca acatccaggg gcagaccttc gcactcgtgc cccaggtggt accctcctcc aacttgaacc tgccctccaa gtttgtgcgc attgcccctg tgcccattgc cgccaagcct gttggatcgg gacccctggg gcctggccct gccggtctcc tcatgggcca gaagttcccc aagaacccag ccgcagaact catcaaaatg cacaaatgta ctttccctgg ctgcagcaag atgtacacca aaagcagcca cctcaaggcc cacctgcgcc ggcacacggg tgagaagccc ttcgcctgca cctggccagg ctgcggctgg aggttctcgc gctctgacga gctgtcgcgg cacaggcgct cgcactcagg tgtgaagccg taccagtgtc ctgtgtgcga gaagaagttc gcgcggagcg accacctctc caagcacatc aaggtgcacc gcttcccgcg gagcagccgc tccgtgcgct ccgtgaactg a. It is sometimes possible for the material contained within the vial of "KLF15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
