Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PMPCB cdna clone

PMPCB cDNA Clone

Gene Names
PMPCB; MPPB; P-52; MPP11; MPPP52; Beta-MPP
Synonyms
PMPCB; PMPCB cDNA Clone; PMPCB cdna clone
Ordering
For Research Use Only!
Sequence
atggctttcaagggcaccaagaagagatcccagttagatctggaacttgagattgaaaatatgggtgctcatctcaatgcctatacctccagagagcagactgtatactatgccaaagcattctctaaagacttgccaagagctgtagaaattcttgctgatataatacaaaacagcacattgggagaagcagagattgaacgtgagcgtggagtaatccttagagagatgcaggaagttgaaaccaatttacaagaagttgtttttgattatcttcatgccacagcttatcaaaatactgcacttggacggacaattttgggaccaactgaaaatatcaaatctataagtcgtaaggacttagtggattatataaccacacattataaggggccaagaatagtgcttgctgctgctggaggtgtttcccatgatgaattgcttgacttagcaaagtttcatttcggtgactctttatgcacacacaaaggagaaataccagctctgcctccctgcaaattcacaggaagtgagattcgtgtgagggatgacaagatgcctttggcgcaccttgcaatagctgttgaagctgttggttgggcacatccagatacaatctgtctcatggttgcaaacacgctgattggcaactgggatcgctcttttgggggaggaatgaatttatctagcaagctggcccagctcacttgtcatggcaatctttgccatagctttcagtctttcaacacttcctacacagatacaggattatggggactgtatatggtttgtgaatcatccactgttgcagacatgctacatgttgttcaaaaagaatggatgcgactctgtacaagtgtcacagaaagtgaggttgcacgagccagaaatcttctgaaaacaaacatgttgttgcagcttgatggttcaactccaatttgtgaagatattggtaggcaaatgttatgctataatagaaggattcccatccctgagcttgaagcaagaattgatgctgtgaatgctgagacaattcgagaagtatgtaccaaatacatttataataggagtccagctattgctgctgttggtcccattaagcaactaccagattttaaacagatacgcagtaacatgtgttggcttcgtgattaa
Sequence Length
1155
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,366 Da
NCBI Official Full Name
Homo sapiens peptidase (mitochondrial processing) beta, mRNA
NCBI Official Synonym Full Names
peptidase, mitochondrial processing beta subunit
NCBI Official Symbol
PMPCB
NCBI Official Synonym Symbols
MPPB; P-52; MPP11; MPPP52; Beta-MPP
NCBI Protein Information
mitochondrial-processing peptidase subunit beta
UniProt Protein Name
Mitochondrial-processing peptidase subunit beta
UniProt Gene Name
PMPCB
UniProt Synonym Gene Names
MPPB
UniProt Entry Name
MPPB_HUMAN

NCBI Description

This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This protein is located in the mitochondrial matrix and catalyzes the cleavage of the leader peptides of precursor proteins newly imported into the mitochondria, though it only functions as part of a heterodimeric complex. [provided by RefSeq, Jul 2008]

Uniprot Description

PMPCB: Cleaves presequences (transit peptides) from mitochondrial protein precursors. Belongs to the peptidase M16 family.

Protein type: Protease; Mitochondrial; EC 3.4.24.64

Chromosomal Location of Human Ortholog: 7q22.1

Cellular Component: mitochondrial respiratory chain complex III

Molecular Function: metalloendopeptidase activity; zinc ion binding

Biological Process: aerobic respiration; mitochondrial electron transport, ubiquinol to cytochrome c; protein processing

Research Articles on PMPCB

Similar Products

Product Notes

The PMPCB pmpcb (Catalog #AAA1269567) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctttca agggcaccaa gaagagatcc cagttagatc tggaacttga gattgaaaat atgggtgctc atctcaatgc ctatacctcc agagagcaga ctgtatacta tgccaaagca ttctctaaag acttgccaag agctgtagaa attcttgctg atataataca aaacagcaca ttgggagaag cagagattga acgtgagcgt ggagtaatcc ttagagagat gcaggaagtt gaaaccaatt tacaagaagt tgtttttgat tatcttcatg ccacagctta tcaaaatact gcacttggac ggacaatttt gggaccaact gaaaatatca aatctataag tcgtaaggac ttagtggatt atataaccac acattataag gggccaagaa tagtgcttgc tgctgctgga ggtgtttccc atgatgaatt gcttgactta gcaaagtttc atttcggtga ctctttatgc acacacaaag gagaaatacc agctctgcct ccctgcaaat tcacaggaag tgagattcgt gtgagggatg acaagatgcc tttggcgcac cttgcaatag ctgttgaagc tgttggttgg gcacatccag atacaatctg tctcatggtt gcaaacacgc tgattggcaa ctgggatcgc tcttttgggg gaggaatgaa tttatctagc aagctggccc agctcacttg tcatggcaat ctttgccata gctttcagtc tttcaacact tcctacacag atacaggatt atggggactg tatatggttt gtgaatcatc cactgttgca gacatgctac atgttgttca aaaagaatgg atgcgactct gtacaagtgt cacagaaagt gaggttgcac gagccagaaa tcttctgaaa acaaacatgt tgttgcagct tgatggttca actccaattt gtgaagatat tggtaggcaa atgttatgct ataatagaag gattcccatc cctgagcttg aagcaagaat tgatgctgtg aatgctgaga caattcgaga agtatgtacc aaatacattt ataataggag tccagctatt gctgctgttg gtcccattaa gcaactacca gattttaaac agatacgcag taacatgtgt tggcttcgtg attaa. It is sometimes possible for the material contained within the vial of "PMPCB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.