Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AICDA cdna clone

AICDA cDNA Clone

Gene Names
AICDA; AID; ARP2; CDA2; HIGM2; HEL-S-284
Synonyms
AICDA; AICDA cDNA Clone; AICDA cdna clone
Ordering
For Research Use Only!
Sequence
atggacagcctcttgatgaaccggaggaagtttctttaccaattcaaaaatgtccgctgggctaagggtcggcgtgagacctacctgtgctacgtagtgaagaggcgtgacagtgctacatccttttcactggactttggttatcttcgcaataagaacggctgccacgtggaattgctcttcctccgctacatctcggactgggacctagaccctggccgctgctaccgcgtcacctggttcacctcctggagcccctgctacgactgtgcccgacatgtggccgactttctgcgagggaaccccaacctcagtctgaggatcttcaccgcgcgcctctacttctgtgaggaccgcaaggctgagcccgaggggctgcggcggctgcaccgcgccggggtgcaaatagccatcatgaccttcaaagattatttttactgctggaatacttttgtagaaaaccatgaaagaactttcaaagcctgggaagggctgcatgaaaattcagttcgtctctccagacagcttcggcgcatccttttgcccctgtatgaggttgatgacttacgagacgcatttcgtactttgggactttga
Sequence Length
597
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,614 Da
NCBI Official Full Name
Homo sapiens activation-induced cytidine deaminase, mRNA
NCBI Official Synonym Full Names
activation induced cytidine deaminase
NCBI Official Symbol
AICDA
NCBI Official Synonym Symbols
AID; ARP2; CDA2; HIGM2; HEL-S-284
NCBI Protein Information
single-stranded DNA cytosine deaminase
UniProt Protein Name
Single-stranded DNA cytosine deaminase
UniProt Gene Name
AICDA
UniProt Synonym Gene Names
AID
UniProt Entry Name
AICDA_HUMAN

NCBI Description

This gene encodes a RNA-editing deaminase that is a member of the cytidine deaminase family. The protein is involved in somatic hypermutation, gene conversion, and class-switch recombination of immunoglobulin genes. Defects in this gene are the cause of autosomal recessive hyper-IgM immunodeficiency syndrome type 2 (HIGM2). [provided by RefSeq, Feb 2009]

Uniprot Description

AID: Single-stranded DNA-specific cytidine deaminase. Involved in somatic hypermutation, gene conversion, and class- switch recombination in B-lymphocytes. Required for several crucial steps of B-cell terminal differentiation necessary for efficient antibody responses. May also play a role in the epigenetic regulation of gene expression by participating in DNA demethylation. Strongly expressed in lymph nodes and tonsils. Belongs to the cytidine and deoxycytidylate deaminase family.

Protein type: Hydrolase; EC 3.5.4.38

Chromosomal Location of Human Ortholog: 12p13

Cellular Component: cytoplasm; exosome (RNase complex); nucleus

Molecular Function: cytidine deaminase activity; protein binding; ubiquitin protein ligase binding

Biological Process: somatic diversification of immunoglobulins; somatic hypermutation of immunoglobulin genes

Disease: Immunodeficiency With Hyper-igm, Type 2

Research Articles on AICDA

Similar Products

Product Notes

The AICDA aicda (Catalog #AAA1269402) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacagcc tcttgatgaa ccggaggaag tttctttacc aattcaaaaa tgtccgctgg gctaagggtc ggcgtgagac ctacctgtgc tacgtagtga agaggcgtga cagtgctaca tccttttcac tggactttgg ttatcttcgc aataagaacg gctgccacgt ggaattgctc ttcctccgct acatctcgga ctgggaccta gaccctggcc gctgctaccg cgtcacctgg ttcacctcct ggagcccctg ctacgactgt gcccgacatg tggccgactt tctgcgaggg aaccccaacc tcagtctgag gatcttcacc gcgcgcctct acttctgtga ggaccgcaag gctgagcccg aggggctgcg gcggctgcac cgcgccgggg tgcaaatagc catcatgacc ttcaaagatt atttttactg ctggaatact tttgtagaaa accatgaaag aactttcaaa gcctgggaag ggctgcatga aaattcagtt cgtctctcca gacagcttcg gcgcatcctt ttgcccctgt atgaggttga tgacttacga gacgcatttc gtactttggg actttga. It is sometimes possible for the material contained within the vial of "AICDA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.