Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NR5A1 cdna clone

NR5A1 cDNA Clone

Gene Names
NR5A1; ELP; SF1; FTZ1; POF7; SF-1; AD4BP; FTZF1; SPGF8; SRXY3; hSF-1
Synonyms
NR5A1; NR5A1 cDNA Clone; NR5A1 cdna clone
Ordering
For Research Use Only!
Sequence
atggactattcgtacgacgaggacctggacgagctgtgccccgtgtgcggggacaaggtgtccggctaccactacggactgctcacgtgtgagagctgcaagggcttcttcaagcgcacggtgcagaacaacaagcactacacgtgcaccgagagccagagctgcaagatcgacaagacgcagcgcaagcgctgtcccttctgccgcttccagaaatgcctgacggtggggatgcgcctggaagccgtgcgcgctgaccgtatgaggggtggccggaacaagtttgggccgatgtacaagcgggaccgggccctgaaacagcagaagaaggcacagattcgggccaatggcttcaagctggagacagggcccccgatgggggtgcccccgccgccccctcccgcaccggactacgtgctgcctcccagcctgcatgggcctgagcccaagggcctggccgccggtccacctgctgggccactgggcgactttggggccccagcactgcccatggccgtgcccggtgcccacgggccactggctggctacctctaccctgcctttcctggccgtgccatcaagtctgagtacccggagccttatgccagccccccacagcctgggctgccgtacggctacccagagcccttctctggagggcccaacgtgcctgagctcatcctgcagctgctgcagctggagccggatgaggaccaggtgcgggcccgcatcttgggctgcctgcaggagcccaccaaaagccgccccgaccagccggcggccttcggcctcctgtgcagaatggccgaccagaccttcatctccatcgtggactgggcacgcaggtgcatggtcttcaaggagctggaggtggccgaccagatgacgctgctgcagaactgctggagcgagctgctggtgttcgaccacatctaccgccaggtccagcacggcaaggagggcagcatcctgctggtcaccgggcaggaggtggagctgaccacagtggccacccaggcgggctcgctgctgcacagcctggtgttgcgggcgcaggagctggtgctgcagctgcttgcgctgcagctggaccggcaggagtttgtctgcctcaagttcatcatcctcttcagcctggatttgaagttcctgaataaccacatcctggtgaaagacgctcaggagaaggccaacgccgccctgcttgactacaccctgtgccactacccgcactgcggggacaaattccagcagctgctgctgtgcctggtggaggtgcgggccctgagcatgcaggccaaggagtacctgtaccacaagcacctgggcaacgagatgccccgcaacaacctgctcatcgaaatgctgcaagccaagcagacttga
Sequence Length
1386
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,636 Da
NCBI Official Full Name
Homo sapiens nuclear receptor subfamily 5, group A, member 1, mRNA
NCBI Official Synonym Full Names
nuclear receptor subfamily 5 group A member 1
NCBI Official Symbol
NR5A1
NCBI Official Synonym Symbols
ELP; SF1; FTZ1; POF7; SF-1; AD4BP; FTZF1; SPGF8; SRXY3; hSF-1
NCBI Protein Information
steroidogenic factor 1
UniProt Protein Name
Steroidogenic factor 1
Protein Family
UniProt Gene Name
NR5A1
UniProt Synonym Gene Names
AD4BP; FTZF1; SF1; SF-1; STF-1; hSF-1
UniProt Entry Name
STF1_HUMAN

NCBI Description

The protein encoded by this gene is a transcriptional activator involved in sex determination. The encoded protein binds DNA as a monomer. Defects in this gene are a cause of XY sex reversal with or without adrenal failure as well as adrenocortical insufficiency without ovarian defect. [provided by RefSeq, Jul 2008]

Uniprot Description

STF-1: a nuclear hormone receptor of the NR5 subfamily. Essential for sexual differentiation and formation of the primary steroidogenic tissues. Binds to the Ad4 site found in the promoter region of steroidogenic P-450 genes such as CYP11A, CYP11B and CYP21B. Also regulates the Muellerian inhibiting substance (AMH) gene as well as the AHCH and STAR genes.

Protein type: Nuclear receptor

Chromosomal Location of Human Ortholog: 9q33

Cellular Component: nucleoplasm; nucleus

Molecular Function: chromatin binding; DNA binding; enzyme binding; ligand-dependent nuclear receptor activity; phospholipid binding; protein binding; RNA polymerase II transcription factor activity, enhancer binding; transcription coactivator activity

Biological Process: cell-cell signaling; hormone-mediated signaling; positive regulation of transcription from RNA polymerase II promoter; primary sex determination; regulation of steroid biosynthetic process; tissue development; transcription initiation from RNA polymerase II promoter

Disease: 46,xy Sex Reversal 3; Premature Ovarian Failure 7; Spermatogenic Failure 8

Research Articles on NR5A1

Similar Products

Product Notes

The NR5A1 nr5a1 (Catalog #AAA1269357) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactatt cgtacgacga ggacctggac gagctgtgcc ccgtgtgcgg ggacaaggtg tccggctacc actacggact gctcacgtgt gagagctgca agggcttctt caagcgcacg gtgcagaaca acaagcacta cacgtgcacc gagagccaga gctgcaagat cgacaagacg cagcgcaagc gctgtccctt ctgccgcttc cagaaatgcc tgacggtggg gatgcgcctg gaagccgtgc gcgctgaccg tatgaggggt ggccggaaca agtttgggcc gatgtacaag cgggaccggg ccctgaaaca gcagaagaag gcacagattc gggccaatgg cttcaagctg gagacagggc ccccgatggg ggtgcccccg ccgccccctc ccgcaccgga ctacgtgctg cctcccagcc tgcatgggcc tgagcccaag ggcctggccg ccggtccacc tgctgggcca ctgggcgact ttggggcccc agcactgccc atggccgtgc ccggtgccca cgggccactg gctggctacc tctaccctgc ctttcctggc cgtgccatca agtctgagta cccggagcct tatgccagcc ccccacagcc tgggctgccg tacggctacc cagagccctt ctctggaggg cccaacgtgc ctgagctcat cctgcagctg ctgcagctgg agccggatga ggaccaggtg cgggcccgca tcttgggctg cctgcaggag cccaccaaaa gccgccccga ccagccggcg gccttcggcc tcctgtgcag aatggccgac cagaccttca tctccatcgt ggactgggca cgcaggtgca tggtcttcaa ggagctggag gtggccgacc agatgacgct gctgcagaac tgctggagcg agctgctggt gttcgaccac atctaccgcc aggtccagca cggcaaggag ggcagcatcc tgctggtcac cgggcaggag gtggagctga ccacagtggc cacccaggcg ggctcgctgc tgcacagcct ggtgttgcgg gcgcaggagc tggtgctgca gctgcttgcg ctgcagctgg accggcagga gtttgtctgc ctcaagttca tcatcctctt cagcctggat ttgaagttcc tgaataacca catcctggtg aaagacgctc aggagaaggc caacgccgcc ctgcttgact acaccctgtg ccactacccg cactgcgggg acaaattcca gcagctgctg ctgtgcctgg tggaggtgcg ggccctgagc atgcaggcca aggagtacct gtaccacaag cacctgggca acgagatgcc ccgcaacaac ctgctcatcg aaatgctgca agccaagcag acttga. It is sometimes possible for the material contained within the vial of "NR5A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.