Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SIRT6 cdna clone

SIRT6 cDNA Clone

Gene Names
SIRT6; SIR2L6
Synonyms
SIRT6; SIRT6 cDNA Clone; SIRT6 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggagcgaggtctggcccccaagttcgacaccacctttgagagcgcgcggcccacgcagacccacatggcgctggtgcagctggagcgcgtgggcctcctccgcttcctggtcagccagaacgtggacgggctccatgtgcgctcaggcttccccagggacaaactggcagagctccacgggaacatgtttgtggaagaatgtgccaagtgtaagacgcagtacgtccgagacacagtcgtgggcaccatgggcctgaaggccacgggccggctctgcaccgtggctaaggcaagggggctgcgagcctgcaggaacgccgacctgtccatcacgctgggtacatcgctgcagatccggcccagcgggaacctgccgctggctaccaagcgccggggaggccgcctggtcatcgtcaacctgcagcccaccaagcacgaccgctatgctgacctccgcatccatggctacgttgacgaggtcatgacccggctcatgaagcacctggggctggagatccccgcctgggacggcccccgtgtgctggagagggcgctgccacccctgccccgcccgcccacccccaagctggagcccaaggaggaatctcccacccggatcaacggctctatccccgccggccccaagcaggagccctgcgcccagcacaacggctcagagcccgccagccccaaacgggagcggcccaccagccctgccccccacagaccccccaaaagggtgaaggccaaggcggtccccagctga
Sequence Length
771
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,065 Da
NCBI Official Full Name
Homo sapiens sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
sirtuin 6
NCBI Official Symbol
SIRT6
NCBI Official Synonym Symbols
SIR2L6
NCBI Protein Information
NAD-dependent protein deacetylase sirtuin-6
UniProt Protein Name
NAD-dependent protein deacetylase sirtuin-6
UniProt Gene Name
SIRT6
UniProt Synonym Gene Names
SIR2L6
UniProt Entry Name
SIR6_HUMAN

NCBI Description

This gene encodes a member of the sirtuin family of NAD-dependent enzymes that are implicated in cellular stress resistance, genomic stability, aging and energy homeostasis. The encoded protein is localized to the nucleus, exhibits ADP-ribosyl transferase and histone deacetylase activities, and plays a role in DNA repair, maintenance of telomeric chromatin, inflammation, lipid and glucose metabolism. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]

Uniprot Description

SIRT6: NAD-dependent protein deacetylase. Has deacetylase activity towards histone H3K9Ac and H3K56Ac. Modulates acetylation of histone H3 in telomeric chromatin during the S-phase of the cell cycle. Deacetylates histone H3K9Ac at NF-kappa-B target promoters and may down-regulate the expression of a subset of NF- kappa-B target genes. Acts as a corepressor of the transcription factor HIF1A to control the expression of multiple glycolytic genes to regulate glucose homeostasis. Required for genomic stability. Regulates the production of TNF protein. Has a role in the regulation of life span. Deacetylation of nucleosomes interferes with RELA binding to target DNA. May be required for the association of WRN with telomeres during S-phase and for normal telomere maintenance. Required for genomic stability. Required for normal IGF1 serum levels and normal glucose homeostasis. Modulates cellular senescence and apoptosis. On DNA damage, promotes DNA end resection via deacetylation of RBBP8. Has very weak deacetylase activity and can bind NAD(+) in the absence of acetylated substrate. Interacts with RELA. Interacts with RBBP8; the interaction deacetylates RBBP8. Belongs to the sirtuin family. Class IV subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.4.2.31; Deacetylase; Transferase; EC 3.5.1.-

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: nuclear telomeric heterochromatin; nucleolus; nucleoplasm; nucleus

Molecular Function: NAD(P)+-protein-arginine ADP-ribosyltransferase activity; NAD+ ADP-ribosyltransferase activity; NAD-dependent histone deacetylase activity; NAD-dependent histone deacetylase activity (H3-K9 specific); protein binding; zinc ion binding

Biological Process: protein amino acid ADP-ribosylation

Research Articles on SIRT6

Similar Products

Product Notes

The SIRT6 sirt6 (Catalog #AAA1269254) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagc gaggtctggc ccccaagttc gacaccacct ttgagagcgc gcggcccacg cagacccaca tggcgctggt gcagctggag cgcgtgggcc tcctccgctt cctggtcagc cagaacgtgg acgggctcca tgtgcgctca ggcttcccca gggacaaact ggcagagctc cacgggaaca tgtttgtgga agaatgtgcc aagtgtaaga cgcagtacgt ccgagacaca gtcgtgggca ccatgggcct gaaggccacg ggccggctct gcaccgtggc taaggcaagg gggctgcgag cctgcaggaa cgccgacctg tccatcacgc tgggtacatc gctgcagatc cggcccagcg ggaacctgcc gctggctacc aagcgccggg gaggccgcct ggtcatcgtc aacctgcagc ccaccaagca cgaccgctat gctgacctcc gcatccatgg ctacgttgac gaggtcatga cccggctcat gaagcacctg gggctggaga tccccgcctg ggacggcccc cgtgtgctgg agagggcgct gccacccctg ccccgcccgc ccacccccaa gctggagccc aaggaggaat ctcccacccg gatcaacggc tctatccccg ccggccccaa gcaggagccc tgcgcccagc acaacggctc agagcccgcc agccccaaac gggagcggcc caccagccct gccccccaca gaccccccaa aagggtgaag gccaaggcgg tccccagctg a. It is sometimes possible for the material contained within the vial of "SIRT6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.