Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAGEB18 cdna clone

MAGEB18 cDNA Clone

Synonyms
MAGEB18; MAGEB18 cDNA Clone; MAGEB18 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctcgaggtcagaagagtaagctccgtgcccgtgagaaacgccaccaggctcgttgtgagaatcaggatctgggagctacgcaggccactgtggcagaaggagagtcaccctcctctgcctatcttctctttggtgacagaccccagaatttgcctgctgctgagacacctagcatccctgaagcgcttcagggagccccatccaccaccaatgctattgcacctgtttcatgcagttcaaatgaaggtgccagcagccaagatgagaaaagtctaggttcctcaagggaagctgagggctggaaagaagatcctttaaacaagaaagtagtgtcgctggtgcatttcttgcttcagaagtatgaaacgaaagagccaattacaaagggagatatgataaagtttgttatcaggaaggataagtgtcacttcaatgagatcctcaagagagcctctgagcacatggagctggcacttggtgttgatttgaaggaagtggatcccatcaggcactactatgcctttttcagcaaattagacctcacctatgatgaaacaaccagtgatgaagaaaaaattcccaagactggcctcctgatgattgcactgggtgtgatctttctgaatggcaaccgtgccccagaagaggcagtctgggaaattatgaatatgatgggtgtatatgctgataggaagcacttcctctatggggatcccaggaaggtcatgaccaaagatttggtgcagctaaagtacctggagtaccagcaagtgcccaacagtgatcctccacgctatgaattcctgtggggtccaagagctcacgctgaaactagcaagatgaaagtcctggagtttgtagccaagatacatgataccgtccctagtgccttcccatcctgctatgaagaggctttgagggatgaggaacagagaacccaagccagagctgcagccagggctcatactgctgccatggcaaatgcacgttccagaaccacgtctagcagcttctcccatgctaagtga
Sequence Length
1032
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,533 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family B, 18, mRNA
NCBI Official Synonym Full Names
MAGE family member B18
NCBI Official Symbol
MAGEB18
NCBI Protein Information
melanoma-associated antigen B18
UniProt Protein Name
Melanoma-associated antigen B18
UniProt Gene Name
MAGEB18
UniProt Entry Name
MAGBI_HUMAN

Uniprot Description

MAGE-B18: May enhance ubiquitin ligase activity of RING-type zinc finger-containing E3 ubiquitin-protein ligases. Proposed to act through recruitment and/or stabilization of the Ubl-conjugating enzyme (E2) at the E3:substrate complex.

Chromosomal Location of Human Ortholog: Xp21.3

Molecular Function: protein binding

Similar Products

Product Notes

The MAGEB18 mageb18 (Catalog #AAA1269236) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcgag gtcagaagag taagctccgt gcccgtgaga aacgccacca ggctcgttgt gagaatcagg atctgggagc tacgcaggcc actgtggcag aaggagagtc accctcctct gcctatcttc tctttggtga cagaccccag aatttgcctg ctgctgagac acctagcatc cctgaagcgc ttcagggagc cccatccacc accaatgcta ttgcacctgt ttcatgcagt tcaaatgaag gtgccagcag ccaagatgag aaaagtctag gttcctcaag ggaagctgag ggctggaaag aagatccttt aaacaagaaa gtagtgtcgc tggtgcattt cttgcttcag aagtatgaaa cgaaagagcc aattacaaag ggagatatga taaagtttgt tatcaggaag gataagtgtc acttcaatga gatcctcaag agagcctctg agcacatgga gctggcactt ggtgttgatt tgaaggaagt ggatcccatc aggcactact atgccttttt cagcaaatta gacctcacct atgatgaaac aaccagtgat gaagaaaaaa ttcccaagac tggcctcctg atgattgcac tgggtgtgat ctttctgaat ggcaaccgtg ccccagaaga ggcagtctgg gaaattatga atatgatggg tgtatatgct gataggaagc acttcctcta tggggatccc aggaaggtca tgaccaaaga tttggtgcag ctaaagtacc tggagtacca gcaagtgccc aacagtgatc ctccacgcta tgaattcctg tggggtccaa gagctcacgc tgaaactagc aagatgaaag tcctggagtt tgtagccaag atacatgata ccgtccctag tgccttccca tcctgctatg aagaggcttt gagggatgag gaacagagaa cccaagccag agctgcagcc agggctcata ctgctgccat ggcaaatgca cgttccagaa ccacgtctag cagcttctcc catgctaagt ga. It is sometimes possible for the material contained within the vial of "MAGEB18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.