Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IGF2 cdna clone

IGF2 cDNA Clone

Gene Names
IGF2; GRDF; IGF-II; PP9974; C11orf43
Synonyms
IGF2; IGF2 cDNA Clone; IGF2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggaatcccaatggggaagtcgatgctggtgcttctcaccttcttggccttcgcctcgtgctgcattgctgcttaccgccccagtgagaccctgtgcggcggggagctggtggacaccctccagttcgtctgtggggaccgcggcttctacttcagcaggcccgcaagccgtgtgagccgtcgcagccgtggcatcgttgaggagtgctgtttccgcagctgtgacctggccctcctggagacgtactgtgctacccccgccaagtccgagagggacgtgtcgacccctccgaccgtgcttccggacaacttccccagataccccgtgggcaagttcttccaatatgacacctggaagcagtccacccagcgcctgcgcaggggcctgcctgccctcctgcgtgcccgccggggtcacgtgctcgccaaggagctcgaggcgttcagggaggccaaacgtcaccgtcccctgattgctctacccacccaagaccccgcccacgggggcgcccccccagagatggccagcaatcggaagtga
Sequence Length
543
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,331 Da
NCBI Official Full Name
Homo sapiens insulin-like growth factor 2 (somatomedin A), mRNA
NCBI Official Synonym Full Names
insulin like growth factor 2
NCBI Official Symbol
IGF2
NCBI Official Synonym Symbols
GRDF; IGF-II; PP9974; C11orf43
NCBI Protein Information
insulin-like growth factor II
UniProt Protein Name
Insulin-like growth factor II
UniProt Gene Name
IGF2
UniProt Synonym Gene Names
IGF-II
UniProt Entry Name
IGF2_HUMAN

NCBI Description

This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]

Uniprot Description

IGF2: The insulin-like growth factors possess growth-promoting activity. In vitro, they are potent mitogens for cultured cells. IGF-II is influenced by placental lactogen and may play a role in fetal development. Epigenetic changes of DNA hypomethylation in IGF2 are a cause of Silver-Russell syndrome (SRS). A clinically heterogeneous condition characterized by severe intrauterine growth retardation, poor postnatal growth, craniofacial features such as a triangular shaped face and a broad forehead, body asymmetry, and a variety of minor malformations. The phenotypic expression changes during childhood and adolescence, with the facial features and asymmetry usually becoming more subtle with age. Belongs to the insulin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 11p15.5

Cellular Component: extracellular region; plasma membrane

Molecular Function: growth factor activity; insulin receptor binding; insulin-like growth factor receptor binding; protein binding; protein serine/threonine kinase activator activity; receptor activator activity

Biological Process: cellular protein metabolic process; genetic imprinting; insulin receptor signaling pathway; multicellular organismal development; platelet degranulation; positive regulation of activated T cell proliferation; positive regulation of catalytic activity; positive regulation of cell proliferation; positive regulation of glycogen biosynthetic process; positive regulation of insulin receptor signaling pathway; positive regulation of MAPKKK cascade; positive regulation of mitosis; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of protein amino acid phosphorylation; positive regulation of protein kinase B signaling cascade; skeletal development

Disease: Beckwith-wiedemann Syndrome; Growth Restriction, Severe, With Distinctive Facies; Silver-russell Syndrome; Wilms Tumor 1

Research Articles on IGF2

Similar Products

Product Notes

The IGF2 igf2 (Catalog #AAA1269214) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaatcc caatggggaa gtcgatgctg gtgcttctca ccttcttggc cttcgcctcg tgctgcattg ctgcttaccg ccccagtgag accctgtgcg gcggggagct ggtggacacc ctccagttcg tctgtgggga ccgcggcttc tacttcagca ggcccgcaag ccgtgtgagc cgtcgcagcc gtggcatcgt tgaggagtgc tgtttccgca gctgtgacct ggccctcctg gagacgtact gtgctacccc cgccaagtcc gagagggacg tgtcgacccc tccgaccgtg cttccggaca acttccccag ataccccgtg ggcaagttct tccaatatga cacctggaag cagtccaccc agcgcctgcg caggggcctg cctgccctcc tgcgtgcccg ccggggtcac gtgctcgcca aggagctcga ggcgttcagg gaggccaaac gtcaccgtcc cctgattgct ctacccaccc aagaccccgc ccacgggggc gcccccccag agatggccag caatcggaag tga. It is sometimes possible for the material contained within the vial of "IGF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.