Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPRY2 cdna clone

SPRY2 cDNA Clone

Gene Names
SPRY2; IGAN3; hSPRY2
Synonyms
SPRY2; SPRY2 cDNA Clone; SPRY2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggccagagctcagagtggcaacgggtcgcagcccttgctgcagacgccccgtgacggtggcagacagcgtggggagcccgaccccagagacgccctcacccagcaggtacatgtcttgtctctggatcagatcagagccatccgaaacaccaatgagtacacagaggggcctactgtcgtcccaagacctgggctcaagcctgctcctcgcccctccactcagcacaaacacgagagactccacggtctgcctgagcaccgccagcctcctaggctccagcactcgcaggtccattcttctgcacgagcctctctgtccagatccataagcacggtcagctcagggtcgcggagcagtacgaggacaagtaccagcagcagctcctctgaacagagactgctaggatcatccttctcctccgggcctgttgctgatggcataatccgggtgcaacccaaatctgagctcaagccaggtgagcttaagccactgagcaaggaagatttgggcctgcacgcctacaggtgtgaggactgtggcaagtgcaaatgtaaggagtgcacctacccaaggcctctgccatcagactggatctgcgacaagcagtgcctttgctcggcccagaacgtgattgactatgggacttgtgtatgctgtgtgaaaggtctcttctatcactgttctaatgatgatgaggacaactgtgctgacaacccatgttcttgcagccagtctcactgttgtacacgatggtcagccatgggtgtcatgtccctctttttgccttgtttatggtgttaccttccagccaagggttgccttaaattgtgccaggggtgttatgaccgggttaacaggcctggttgccgctgtaaaaactcaaacacagtttgctgcaaagttcccactgtcccccctagaactttgaaaaaccaacatagcatcattaatcaggaatattacagtaatgaggattttttctgtctttttttaatacacatatgcaaccaactaaacagttataatcttggcactgttaatagaaagttgggatag
Sequence Length
1062
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,688 Da
NCBI Official Full Name
Homo sapiens sprouty homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
sprouty RTK signaling antagonist 2
NCBI Official Symbol
SPRY2
NCBI Official Synonym Symbols
IGAN3; hSPRY2
NCBI Protein Information
protein sprouty homolog 2
UniProt Protein Name
Protein sprouty homolog 2
Protein Family
UniProt Gene Name
SPRY2
UniProt Synonym Gene Names
Spry-2
UniProt Entry Name
SPY2_HUMAN

NCBI Description

This gene encodes a protein belonging to the sprouty family. The encoded protein contains a carboxyl-terminal cysteine-rich domain essential for the inhibitory activity on receptor tyrosine kinase signaling proteins and is required for growth factor stimulated translocation of the protein to membrane ruffles. In primary dermal endothelial cells this gene is transiently upregulated in response to fibroblast growth factor two. This protein is indirectly involved in the non-cell autonomous inhibitory effect on fibroblast growth factor two signaling. The protein interacts with Cas-Br-M (murine) ectropic retroviral transforming sequence, and can function as a bimodal regulator of epidermal growth factor receptor/mitogen-activated protein kinase signaling. This protein may play a role in alveoli branching during lung development as shown by a similar mouse protein. [provided by RefSeq, Jul 2008]

Uniprot Description

SPRY2: a feedback inhibitor of growth factor receptor signaling. Belongs to the sprouty family. May function as an antagonist of fibroblast growth factor (FGF) pathways and may negatively modulate respiratory organogenesis. Associated with microtubules in unstimulated cells but is translocated to the membrane ruffles in cells stimulated with EGF (epidermal growth factor).

Protein type: Motility/polarity/chemotaxis; Adaptor/scaffold; Inhibitor

Chromosomal Location of Human Ortholog: 13q31.1

Cellular Component: cytoskeleton; cytosol; membrane; nucleus; plasma membrane

Molecular Function: protein binding; protein kinase binding; protein serine/threonine kinase activator activity; protein serine/threonine kinase inhibitor activity

Biological Process: negative regulation of apoptosis; negative regulation of cell projection organization and biogenesis; negative regulation of epidermal growth factor receptor signaling pathway; positive regulation of peptidyl-serine phosphorylation; positive regulation of protein kinase B signaling cascade

Disease: Iga Nephropathy, Susceptibility To, 3

Research Articles on SPRY2

Similar Products

Product Notes

The SPRY2 spry2 (Catalog #AAA1269193) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcca gagctcagag tggcaacggg tcgcagccct tgctgcagac gccccgtgac ggtggcagac agcgtgggga gcccgacccc agagacgccc tcacccagca ggtacatgtc ttgtctctgg atcagatcag agccatccga aacaccaatg agtacacaga ggggcctact gtcgtcccaa gacctgggct caagcctgct cctcgcccct ccactcagca caaacacgag agactccacg gtctgcctga gcaccgccag cctcctaggc tccagcactc gcaggtccat tcttctgcac gagcctctct gtccagatcc ataagcacgg tcagctcagg gtcgcggagc agtacgagga caagtaccag cagcagctcc tctgaacaga gactgctagg atcatccttc tcctccgggc ctgttgctga tggcataatc cgggtgcaac ccaaatctga gctcaagcca ggtgagctta agccactgag caaggaagat ttgggcctgc acgcctacag gtgtgaggac tgtggcaagt gcaaatgtaa ggagtgcacc tacccaaggc ctctgccatc agactggatc tgcgacaagc agtgcctttg ctcggcccag aacgtgattg actatgggac ttgtgtatgc tgtgtgaaag gtctcttcta tcactgttct aatgatgatg aggacaactg tgctgacaac ccatgttctt gcagccagtc tcactgttgt acacgatggt cagccatggg tgtcatgtcc ctctttttgc cttgtttatg gtgttacctt ccagccaagg gttgccttaa attgtgccag gggtgttatg accgggttaa caggcctggt tgccgctgta aaaactcaaa cacagtttgc tgcaaagttc ccactgtccc ccctagaact ttgaaaaacc aacatagcat cattaatcag gaatattaca gtaatgagga ttttttctgt ctttttttaa tacacatatg caaccaacta aacagttata atcttggcac tgttaataga aagttgggat ag. It is sometimes possible for the material contained within the vial of "SPRY2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.