Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRKACB cdna clone

PRKACB cDNA Clone

Gene Names
PRKACB; PKACB; PKA C-beta
Synonyms
PRKACB; PRKACB cDNA Clone; PRKACB cdna clone
Ordering
For Research Use Only!
Sequence
atggggaacgcggcgaccgccaagaaaggcagcgaggtggagagcgtgaaagagtttctagccaaagccaaagaagactttttgaaaaaatgggagaatccaactcagaataatgccggacttgaagattttgaaaggaaaaaaacccttggaacaggttcatttggaagagtcatgttggtaaaacacaaagccactgaacagtattatgccatgaagatcttagataagcagaaggttgttaaactgaagcaaatagagcatactttgaatgagaaaagaatattacaggcagtgaattttcctttccttgttcgactggagtatgcttttaaggataattctaatttatacatggttatggaatatgtccctgggggtgaaatgttttcacatctaagaagaattggaaggttcagtgagccccatgcacggttctatgcagctcagatagtgctaacattcgagtacctccattcactagacctcatctacagagatctaaaacctgaaaatctcttaattgaccatcaaggctatatccaggtcacagactttgggtttgccaaaagagttaaaggcagaacttggacattatgtggaactccagagtatttggctccagaaataattctcagcaagggctacaataaggcagtggattggtgggcattaggagtgctaatctatgaaatggcagctggctatcccccattctttgcagaccaaccaattcagatttatgaaaagattgtttctggaaagaacttttga
Sequence Length
774
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,979 Da
NCBI Official Full Name
Homo sapiens protein kinase, cAMP-dependent, catalytic, beta, mRNA
NCBI Official Synonym Full Names
protein kinase cAMP-activated catalytic subunit beta
NCBI Official Symbol
PRKACB
NCBI Official Synonym Symbols
PKACB; PKA C-beta
NCBI Protein Information
cAMP-dependent protein kinase catalytic subunit beta
UniProt Protein Name
cAMP-dependent protein kinase catalytic subunit beta
UniProt Gene Name
PRKACB
UniProt Synonym Gene Names
PKA C-beta
UniProt Entry Name
KAPCB_HUMAN

NCBI Description

The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014]

Uniprot Description

PKACB: Mediates cAMP-dependent signaling triggered by receptor binding to GPCRs. PKA activation regulates diverse cellular processes such as cell proliferation, the cell cycle, differentiation and regulation of microtubule dynamics, chromatin condensation and decondensation, nuclear envelope disassembly and reassembly, as well as regulation of intracellular transport mechanisms and ion flux. Regulates the abundance of compartmentalized pools of its regulatory subunits through phosphorylation of PJA2 which binds and ubiquitinates these subunits, leading to their subsequent proteolysis. A number of inactive tetrameric holoenzymes are produced by the combination of homo- or heterodimers of the different regulatory subunits associated with two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. The cAMP-dependent protein kinase catalytic subunit binds PJA2. Isoform 1 is most abundant in the brain, with low level expression in kidney. Isoform 2 is predominantly expressed in thymus, spleen and kidney. Isoform 3 and isoform 4 are only expressed in the brain. Activated by cAMP. Belongs to the protein kinase superfamily. AGC Ser/Thr protein kinase family. cAMP subfamily. 9 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein kinase, AGC; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.11; Kinase, protein; AGC group; PKA family

Chromosomal Location of Human Ortholog: 1p31.1

Cellular Component: cAMP-dependent protein kinase complex; centrosome; cytosol; nucleoplasm

Molecular Function: ATP binding; cAMP-dependent protein kinase activity; kinase activity; magnesium ion binding; protein binding; protein serine/threonine kinase activity; ubiquitin protein ligase binding

Biological Process: activation of protein kinase A; blood coagulation; G-protein signaling, coupled to cAMP nucleotide second messenger; lipoprotein metabolic process; protein amino acid phosphorylation; renal water homeostasis; signal transduction; stimulatory C-type lectin receptor signaling pathway

Research Articles on PRKACB

Similar Products

Product Notes

The PRKACB prkacb (Catalog #AAA1269178) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaacg cggcgaccgc caagaaaggc agcgaggtgg agagcgtgaa agagtttcta gccaaagcca aagaagactt tttgaaaaaa tgggagaatc caactcagaa taatgccgga cttgaagatt ttgaaaggaa aaaaaccctt ggaacaggtt catttggaag agtcatgttg gtaaaacaca aagccactga acagtattat gccatgaaga tcttagataa gcagaaggtt gttaaactga agcaaataga gcatactttg aatgagaaaa gaatattaca ggcagtgaat tttcctttcc ttgttcgact ggagtatgct tttaaggata attctaattt atacatggtt atggaatatg tccctggggg tgaaatgttt tcacatctaa gaagaattgg aaggttcagt gagccccatg cacggttcta tgcagctcag atagtgctaa cattcgagta cctccattca ctagacctca tctacagaga tctaaaacct gaaaatctct taattgacca tcaaggctat atccaggtca cagactttgg gtttgccaaa agagttaaag gcagaacttg gacattatgt ggaactccag agtatttggc tccagaaata attctcagca agggctacaa taaggcagtg gattggtggg cattaggagt gctaatctat gaaatggcag ctggctatcc cccattcttt gcagaccaac caattcagat ttatgaaaag attgtttctg gaaagaactt ttga. It is sometimes possible for the material contained within the vial of "PRKACB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.