Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF189 cdna clone

ZNF189 cDNA Clone

Synonyms
ZNF189; ZNF189 cDNA Clone; ZNF189 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttccccgagccccccgccggagtcgaaggaggagtgggattatctggacccagctcagagaagcctgtataaagatgtcatgatggagaattatggaaacctggtctcactggatgttttgaacagagataaggatgaggagccaactgtaaaacaagagattgaagaaattgaggaagaagtggaaccacagggtgtaatagttacaagaatcaaaagtgaaattgaccaggatcctatgggtagagaaacatttgaacttgttggtaggttagataaacaaagagggatcttcctatgggaaataccaagggaatctttgacccaggaacagagaatgttcagagaaaacactaacattatccgtaaaagaccaaactcagaagagaaatgccataaatgtgaagaatgtggaaagggttttgtccgcaaggcccatttcattcaacatcaaagggtccatactggtgagaaaccttttcagtgcaatgaatgtgggaaaagttttagtcgcagttcatttgttattgaacatcagagaattcacactggggaaaggccctatgagtgtaattactgtggaaaaacctttagtgtgagctcaacccttattagacatcagagaatccacactggagaaagaccctatcagtgtaatcagtgtaaacagagcttcagccagagaaggagccttgttaaacatcaaaggattcatacaggtgagaaaccccataaatgtagtgactgtgggaaagccttcagttggaaatcacaccttattgagcatcaaagaactcacactggtgagaaaccttatcactgtaccaaatgtaagaagagctttagtcgaaattcattgcttgttgagcatcaaagaattcacactggggaaagaccccataaatgtggtgaatgtgggaaagcctttcgattaagcacataccttatacaacaccaaaaaattcacactggcgagaagccttttctttgtattgagtgtggaaaaagtttcagtcggagctcattccttattgaacatcagaggatccatactggtgaaagaccttatcagtgcaaagagtgtgggaaaagtttcagtcagctttgcaaccttactcgtcatcagagaattcacacaggagacaagccccataaatgtgaggaatgtggaaaagcctttagtagaagctcaggtcttattcagcatcagagaattcacaccagggagaagacttatccatacaatgaaactaaggaaagttttgatccaaattgcagtcttgttatacagcaggaagtctaccctaaggagaaatcttataaatgtgatgaatgtgggaaaacttttagtgttagtgctcatcttgtacaacatcaaagaatccacactggtgaaaagccctatctatgtactgtctgtgggaaaagcttcagccggagctcatttcttattgaacatcagagaatccacactggtgagagaccctatctgtgcagacagtgtggaaaaagctttagtcagctttgtaatcttattcgacatcagggtgttcacacaggtaataaaccccataaatgtgatgaatgtggaaaggcctttagccggaactcgggtcttattcagcatcagagaatacacacaggagagaaaccttataagtgtgagaagtgcgacaaaagtttcagtcaacagcgcagtcttgtcaaccatcagaagatccatgcagaggtgaaaacccaagaaacccatgaatgtgacgcttgtggtgaagcctttaattgccgtatttctcttattcagcatcagaaattgcacacagcatggatgcaataa
Sequence Length
1839
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,188 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 189, mRNA
NCBI Official Synonym Full Names
zinc finger protein 189
NCBI Official Symbol
ZNF189
NCBI Protein Information
zinc finger protein 189
UniProt Protein Name
Zinc finger protein 189
Protein Family
UniProt Gene Name
ZNF189
UniProt Entry Name
ZN189_HUMAN

NCBI Description

Kruppel-like zinc finger proteins such as ZNF189 contain a conserved stretch of 7 amino acids that connects a variable number of DNA-binding zinc finger repeats of the cys(2)his(2) (C2H2) type (summarized by Odeberg et al., 1998 [PubMed 9653648]). Approximately 30% of human Kruppel-like zinc finger proteins contain an N-terminal Kruppel-associated box (KRAB) domain. The KRAB domain consists of approximately 75 amino acids that may be subdivided into an A box, which is present in every KRAB domain and is essential for transcriptional repression, and a B box, which is not always present.[supplied by OMIM, May 2010]

Uniprot Description

ZNF189: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; C2H2-type zinc finger protein; Transcription factor

Chromosomal Location of Human Ortholog: 9q22-q31

Molecular Function: transcription factor activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter; positive regulation of defense response to virus by host

Research Articles on ZNF189

Similar Products

Product Notes

The ZNF189 znf189 (Catalog #AAA1269160) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttccc cgagcccccc gccggagtcg aaggaggagt gggattatct ggacccagct cagagaagcc tgtataaaga tgtcatgatg gagaattatg gaaacctggt ctcactggat gttttgaaca gagataagga tgaggagcca actgtaaaac aagagattga agaaattgag gaagaagtgg aaccacaggg tgtaatagtt acaagaatca aaagtgaaat tgaccaggat cctatgggta gagaaacatt tgaacttgtt ggtaggttag ataaacaaag agggatcttc ctatgggaaa taccaaggga atctttgacc caggaacaga gaatgttcag agaaaacact aacattatcc gtaaaagacc aaactcagaa gagaaatgcc ataaatgtga agaatgtgga aagggttttg tccgcaaggc ccatttcatt caacatcaaa gggtccatac tggtgagaaa ccttttcagt gcaatgaatg tgggaaaagt tttagtcgca gttcatttgt tattgaacat cagagaattc acactgggga aaggccctat gagtgtaatt actgtggaaa aacctttagt gtgagctcaa cccttattag acatcagaga atccacactg gagaaagacc ctatcagtgt aatcagtgta aacagagctt cagccagaga aggagccttg ttaaacatca aaggattcat acaggtgaga aaccccataa atgtagtgac tgtgggaaag ccttcagttg gaaatcacac cttattgagc atcaaagaac tcacactggt gagaaacctt atcactgtac caaatgtaag aagagcttta gtcgaaattc attgcttgtt gagcatcaaa gaattcacac tggggaaaga ccccataaat gtggtgaatg tgggaaagcc tttcgattaa gcacatacct tatacaacac caaaaaattc acactggcga gaagcctttt ctttgtattg agtgtggaaa aagtttcagt cggagctcat tccttattga acatcagagg atccatactg gtgaaagacc ttatcagtgc aaagagtgtg ggaaaagttt cagtcagctt tgcaacctta ctcgtcatca gagaattcac acaggagaca agccccataa atgtgaggaa tgtggaaaag cctttagtag aagctcaggt cttattcagc atcagagaat tcacaccagg gagaagactt atccatacaa tgaaactaag gaaagttttg atccaaattg cagtcttgtt atacagcagg aagtctaccc taaggagaaa tcttataaat gtgatgaatg tgggaaaact tttagtgtta gtgctcatct tgtacaacat caaagaatcc acactggtga aaagccctat ctatgtactg tctgtgggaa aagcttcagc cggagctcat ttcttattga acatcagaga atccacactg gtgagagacc ctatctgtgc agacagtgtg gaaaaagctt tagtcagctt tgtaatctta ttcgacatca gggtgttcac acaggtaata aaccccataa atgtgatgaa tgtggaaagg cctttagccg gaactcgggt cttattcagc atcagagaat acacacagga gagaaacctt ataagtgtga gaagtgcgac aaaagtttca gtcaacagcg cagtcttgtc aaccatcaga agatccatgc agaggtgaaa acccaagaaa cccatgaatg tgacgcttgt ggtgaagcct ttaattgccg tatttctctt attcagcatc agaaattgca cacagcatgg atgcaataa. It is sometimes possible for the material contained within the vial of "ZNF189, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.