Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OAT cdna clone

OAT cDNA Clone

Gene Names
OAT; OKT; GACR; HOGA; OATASE
Synonyms
OAT; OAT cDNA Clone; OAT cdna clone
Ordering
For Research Use Only!
Sequence
atgttttccaaactagcacatttgcagaggtttgctgtacttagtcgcggagttcattcttcagtggcttctgctacatctgttgcaactaaaaaaacagtccaaggccctccaacctctgatgacatttttgaaagggaatataagtatggtgcacacaactaccatcctttacctgtagccctggagagaggaaaaggtatttacttatgggatgtagaaggcagaaaatattttgacttcctgagttcttacagtgctgtcaaccaagggcattgtcaccccaagattgtgaatgctctgaagagtcaagtggacaaattgaccttaacatctagagctttctataataacgtacttggtgaatatgaggagtatattactaaacttttcaactaccacaaagttcttcctatgaatacaggagtggaggctggagagactgcctgtaaactagctcgtaagtggggctataccgtgaagggcattcagaaatacaaagcaaagattgtttttgcagctgggaacttctggggtaggacgttgtctgctatctccagttccacagacccaaccagttacgatggttttggaccatttatgccgggattcgacatcattccctataatgatctgcccgcactggagcgtgctcttcaggatccaaatgtggctgcgttcatggtagaaccaattcagggtgaagcaggcgttgttgttccggatccaggttacctaatgggagtgcgagagctctgcaccaggcaccaggttctctttattgctgatgaaatacagacaggattggccagaactggtagatggctggctgttgattatgaaaatgtcagacctgatatagtcctccttggaaaggccctttctgggggcttataccctgtgtctgcagtgctgtgtgatgatgacatcatgctgaccattaagccaggggagcatgggtccacatacggtggcaatccactaggctgccgagtggccatcgcagcccttgaggttttagaagaagaaaaccttgctgaaaatgcagacaaattgggcattatcttgagaaatgaactcatgaagctaccttctgatgttgtaactgccgtaagaggaaaaggattattaaacgctattgtcattaaagaaaccaaagattgggatgcttggaaggtgtgtctacgacttcgagataatggacttctggccaagccaacccatggcgacattatcaggtttgcgcctccgctggtgatcaaggaggatgagcttcgagagtccattgaaattattaacaagaccatcttgtctttctga
Sequence Length
1320
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,853 Da
NCBI Official Full Name
Homo sapiens ornithine aminotransferase (gyrate atrophy), mRNA
NCBI Official Synonym Full Names
ornithine aminotransferase
NCBI Official Symbol
OAT
NCBI Official Synonym Symbols
OKT; GACR; HOGA; OATASE
NCBI Protein Information
ornithine aminotransferase, mitochondrial
UniProt Protein Name
Ornithine aminotransferase, mitochondrial
UniProt Gene Name
OAT
UniProt Entry Name
OAT_HUMAN

NCBI Description

This gene encodes the mitochondrial enzyme ornithine aminotransferase, which is a key enzyme in the pathway that converts arginine and ornithine into the major excitatory and inhibitory neurotransmitters glutamate and GABA. Mutations that result in a deficiency of this enzyme cause the autosomal recessive eye disease Gyrate Atrophy. Alternatively spliced transcript variants encoding different isoforms have been described. Related pseudogenes have been defined on the X chromosome. [provided by RefSeq, Jan 2010]

Uniprot Description

OAT: Defects in OAT are the cause of hyperornithinemia with gyrate atrophy of choroid and retina (HOGA). HOGA is a slowly progressive blinding autosomal recessive disorder. Belongs to the class-III pyridoxal-phosphate-dependent aminotransferase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transferase; Amino Acid Metabolism - arginine and proline; EC 2.6.1.13; Mitochondrial

Chromosomal Location of Human Ortholog: 10q26

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: identical protein binding; ornithine-oxo-acid transaminase activity; pyridoxal phosphate binding

Biological Process: amino acid biosynthetic process; arginine catabolic process to glutamate; arginine catabolic process to proline via ornithine; visual perception

Disease: Gyrate Atrophy Of Choroid And Retina

Research Articles on OAT

Similar Products

Product Notes

The OAT oat (Catalog #AAA1269144) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttttcca aactagcaca tttgcagagg tttgctgtac ttagtcgcgg agttcattct tcagtggctt ctgctacatc tgttgcaact aaaaaaacag tccaaggccc tccaacctct gatgacattt ttgaaaggga atataagtat ggtgcacaca actaccatcc tttacctgta gccctggaga gaggaaaagg tatttactta tgggatgtag aaggcagaaa atattttgac ttcctgagtt cttacagtgc tgtcaaccaa gggcattgtc accccaagat tgtgaatgct ctgaagagtc aagtggacaa attgacctta acatctagag ctttctataa taacgtactt ggtgaatatg aggagtatat tactaaactt ttcaactacc acaaagttct tcctatgaat acaggagtgg aggctggaga gactgcctgt aaactagctc gtaagtgggg ctataccgtg aagggcattc agaaatacaa agcaaagatt gtttttgcag ctgggaactt ctggggtagg acgttgtctg ctatctccag ttccacagac ccaaccagtt acgatggttt tggaccattt atgccgggat tcgacatcat tccctataat gatctgcccg cactggagcg tgctcttcag gatccaaatg tggctgcgtt catggtagaa ccaattcagg gtgaagcagg cgttgttgtt ccggatccag gttacctaat gggagtgcga gagctctgca ccaggcacca ggttctcttt attgctgatg aaatacagac aggattggcc agaactggta gatggctggc tgttgattat gaaaatgtca gacctgatat agtcctcctt ggaaaggccc tttctggggg cttataccct gtgtctgcag tgctgtgtga tgatgacatc atgctgacca ttaagccagg ggagcatggg tccacatacg gtggcaatcc actaggctgc cgagtggcca tcgcagccct tgaggtttta gaagaagaaa accttgctga aaatgcagac aaattgggca ttatcttgag aaatgaactc atgaagctac cttctgatgt tgtaactgcc gtaagaggaa aaggattatt aaacgctatt gtcattaaag aaaccaaaga ttgggatgct tggaaggtgt gtctacgact tcgagataat ggacttctgg ccaagccaac ccatggcgac attatcaggt ttgcgcctcc gctggtgatc aaggaggatg agcttcgaga gtccattgaa attattaaca agaccatctt gtctttctga. It is sometimes possible for the material contained within the vial of "OAT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.