TROAP cdna clone
TROAP cDNA Clone
Gene Names
TROAP; TASTIN
Synonyms
TROAP; TROAP cDNA Clone; TROAP cdna clone
Sequence
atgaccacccggcaagccacgaaggatcccctcctccggggtgtatctcctacccctagcaagattccggtacgctctcagaaacgcacgcctttccccactgttacatcgtgcgccgtggaccaggagaaccaagatccaaggagatgggtgcagaaaccaccgctcaatattcaacgccccctcgttgattcagcaggccccaggccgaaagccaggcaccaggcagagacatcacaaagattggtggggatcagtcagcctcggaaccccttggaagagctcaggcctagccctaggggtcaaaatgtggggcctgggccccctgcccagacagtcctggtcccagctcctggaaagctctttgctcttagaagatctccctttcctccagcaaaatgtcatctcgccaggtgccatggcttgtacctgtaa
Sequence Length
435
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
13,723 Da
NCBI Official Full Name
Homo sapiens trophinin associated protein (tastin), mRNA
NCBI Official Synonym Full Names
trophinin associated protein
NCBI Official Symbol
TROAP
NCBI Official Synonym Symbols
TASTIN
NCBI Protein Information
tastin
UniProt Protein Name
Tastin
Protein Family
UniProt Gene Name
TROAP
UniProt Entry Name
TROAP_HUMAN
Uniprot Description
TROAP: Could be involved with bystin and trophinin in a cell adhesion molecule complex that mediates an initial attachment of the blastocyst to uterine epithelial cells at the time of the embryo implantation. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell adhesion
Chromosomal Location of Human Ortholog: 12q13.12
Molecular Function: protein binding
Research Articles on TROAP
Similar Products
Product Notes
The TROAP troap (Catalog #AAA1269102) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccaccc ggcaagccac gaaggatccc ctcctccggg gtgtatctcc tacccctagc aagattccgg tacgctctca gaaacgcacg cctttcccca ctgttacatc gtgcgccgtg gaccaggaga accaagatcc aaggagatgg gtgcagaaac caccgctcaa tattcaacgc cccctcgttg attcagcagg ccccaggccg aaagccaggc accaggcaga gacatcacaa agattggtgg ggatcagtca gcctcggaac cccttggaag agctcaggcc tagccctagg ggtcaaaatg tggggcctgg gccccctgcc cagacagtcc tggtcccagc tcctggaaag ctctttgctc ttagaagatc tccctttcct ccagcaaaat gtcatctcgc caggtgccat ggcttgtacc tgtaa. It is sometimes possible for the material contained within the vial of "TROAP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
