Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DTD1 cdna clone

DTD1 cDNA Clone

Gene Names
DTD1; DUEB; DUE-B; HARS2; pqn-68; C20orf88
Synonyms
DTD1; DTD1 cDNA Clone; DTD1 cdna clone
Ordering
For Research Use Only!
Sequence
ATGAAGGCCGTGGTGCAGCGCGTCACCCGGGCCAGCGTCACAGTTGGAGGAGAGCAGATTAGTGCCATTGGAAGGGGCATATGTGTGTTGCTGGGTATTTCCCTGGAGGATACGCAGAAGGAACTGGAACACATGGTCCGAAAGATTCTAAACCTGCGTGTATTTGAGGATGAGAGTGGGAAGCACTGGTCGAAGAGTGTGATGGACAAACAGTACGAGATTCTGTGTGTCAGCCAGTTTACCCTCCAGTGTGTCCTGAAGGGAAACAAGCCTGATTTCCACCTAGCAATGCCCACGGAGCAGGCAGAGGGCTTCTACAACAGCTTCCTGGAGCAGCTGCGTAAAACATACAGGCCGGAGCTTATCAAAGATGGCAAGTTTGGGGCCTACATGCAGGTGCACATTCAGAATGATGGGCCTGTGACCATAGAGCTGGAATCGCCAGCTCCCGGCACTGCTACCTCTGACCCAAAGCAGCTGTCAAAGCTCGAAAAACAGCAGCAGAGGAAAGAAAAGACCAGAGCTAAGGGACCTTCTGAATCAAGCAAGGAAAGAAACACTCCCCGAAAAGAAGACCGCAGTGCCAGCAGCGGGGCTGAGGGCGACGTGTCCTCTGAACGGGAGCCGTAG
Sequence Length
630
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,424 Da
NCBI Official Full Name
Homo sapiens D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
D-tyrosyl-tRNA deacylase 1
NCBI Official Symbol
DTD1
NCBI Official Synonym Symbols
DUEB; DUE-B; HARS2; pqn-68; C20orf88
NCBI Protein Information
D-tyrosyl-tRNA(Tyr) deacylase 1
UniProt Protein Name
D-tyrosyl-tRNA(Tyr) deacylase 1
UniProt Gene Name
DTD1
UniProt Synonym Gene Names
C20orf88; DUEB; HARS2; DUE-B
UniProt Entry Name
DTD1_HUMAN

NCBI Description

The protein encoded by this gene is similar in sequence to histidyl-tRNA synthetase, which hydrolyzes D-tyrosyl-tRNA(Tyr) into D-tyrosine and free tRNA(Tyr). The encoded protein binds the DNA unwinding element and plays a role in the initiation of DNA replication. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Uniprot Description

DTD1: Hydrolyzes D-tyrosyl-tRNA(Tyr) into D-tyrosine and free tRNA(Tyr). Could be a defense mechanism against a harmful effect of D-tyrosine (Potential). Belongs to the DTD family.

Protein type: EC 3.1.-.-; Hydrolase; DNA replication

Chromosomal Location of Human Ortholog: 20p11.23

Cellular Component: cytoplasm

Molecular Function: D-tyrosyl-tRNA(Tyr) deacylase activity

Biological Process: tRNA metabolic process

Research Articles on DTD1

Similar Products

Product Notes

The DTD1 dtd1 (Catalog #AAA1269088) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAAGGCCG TGGTGCAGCG CGTCACCCGG GCCAGCGTCA CAGTTGGAGG AGAGCAGATT AGTGCCATTG GAAGGGGCAT ATGTGTGTTG CTGGGTATTT CCCTGGAGGA TACGCAGAAG GAACTGGAAC ACATGGTCCG AAAGATTCTA AACCTGCGTG TATTTGAGGA TGAGAGTGGG AAGCACTGGT CGAAGAGTGT GATGGACAAA CAGTACGAGA TTCTGTGTGT CAGCCAGTTT ACCCTCCAGT GTGTCCTGAA GGGAAACAAG CCTGATTTCC ACCTAGCAAT GCCCACGGAG CAGGCAGAGG GCTTCTACAA CAGCTTCCTG GAGCAGCTGC GTAAAACATA CAGGCCGGAG CTTATCAAAG ATGGCAAGTT TGGGGCCTAC ATGCAGGTGC ACATTCAGAA TGATGGGCCT GTGACCATAG AGCTGGAATC GCCAGCTCCC GGCACTGCTA CCTCTGACCC AAAGCAGCTG TCAAAGCTCG AAAAACAGCA GCAGAGGAAA GAAAAGACCA GAGCTAAGGG ACCTTCTGAA TCAAGCAAGG AAAGAAACAC TCCCCGAAAA GAAGACCGCA GTGCCAGCAG CGGGGCTGAG GGCGACGTGT CCTCTGAACG GGAGCCGTAG. It is sometimes possible for the material contained within the vial of "DTD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.