ZER1 cdna clone
ZER1 cDNA Clone
Gene Names
ZER1; ZYG; C9orf60; ZYG11BL
Synonyms
ZER1; ZER1 cDNA Clone; ZER1 cdna clone
Sequence
atggcgtccgacactcccgagtcgctgatggccctctgtactgacttctgcttgcgcaacctggatggcaccctgggctacctgctggacaaggagaccctgcggctacatccggacatcttcttgcccagcgagatctgtgaccggctcgtcaatgagtatgtggagctggtgaacgctgcctgtaacttcgagccacacgagagcttcttcagcctcttttcggacccccgcagcacccgcctcacgcggatccacctccgtgaggacctggtgcaggaccaggacctggaggccatccgcaagcaggacctggtggagctgtacctgactaactgcgagaagctgtccgccaagagcctgcagacactgaggagcttcagccacaccctggtgtccttgagcctcttcggctgtacaaacattttctatgaggaggagaacccagggggctgtgaagatgagtacctcgtcaaccccacctgccaggtgctggttaaggatttcaccttcgagggcttcagccgcctccgcttcctcaacttgggccgcatgattgattgggtccctgtggagtccctgctgcggccgcttaactccctggctgccttggacctctcaggcattcagacgagcgacgccgccttcctcacccagtggaaagacagcctggtgtccctcgtcctctacaacatggacctgtccgacgaccacatccgggtcatcgtgcagctgcacaagctgcgacacctggacatctcccgagaccgcctctccagctactacaagttcaagctgactcgggaggtgctgagcctctttgtgcagaagctggggaacctaatgtccctggacatctctggccacatgatcctagagaactgcagcatctccaagatggaagaggaagcggggcagaccagcattgagccttccaagagcagcatcatacctttccgggctctgaagaggccgctgcagttcctcgggctctttgagaactctctgtgccgcctcacgcacattccagcctacaaagtaagtggtgacaaaaacgaagagcaggtgctgaatgccatcgaggcctacacggagcaccggcctgagatcacctcgcgggccatcaacttgctttttgacatcgcccgcatcgagcgttgcaaccagctgctgcgggccctgaagctggtcatcacggccctcaagtgccacaaatatgacaggaacattcaagtgacaggcagcgccgctctcttctacctaacaaattccgagtaccgctcagagcagagtgtgaagctgcgccggcaggttatccaggtggtgctgaatggcatggaatcctaccaggaggtgacggtgcagcggaactgctgcctgacgctctgcaacttcagcatccccgaggagctggaattccagtaccgccgggtcaacgagctcctgctcagcatcctcaaccccacgcggcaggacgagtctatccagcggatcgccgtgcacctgtgcaatgccctggtctgccaggtagacaacgaccacaaggaggccgtgggcaagatgggctttgtcgtgaccatgctgaagctgattcagaagaagctgctggacaagacatgtgaccaggtcatggagttctcctggagtgccctgtggaacatcacagatgaaactcctgacaactgcgagatgttcctcaatttcaacggcatgaagctcttcctggactgcctgaaggaattcccagagaagcaggaactgcataggaatatgctaggacttttggggaatgtggcagaagtgaaggagctgaggcctcaactaatgacttcccagttcatcagcgtcttcagcaacctgttggagagcaaggccgatgggatcgaggtttcctacaatgcctgcggcgtcctctcccacatcatgtttgatggacccgaggcctggggcgtctgtgagccccagcgtgaggaggtggaggaacgcatgtgggctgccatccagagctgggacataaactctcggagaaacatcaattacaggtcatttgaaccaattctccgcctccttccccagggaatctctcctgtcagccagcactgggcaacctgggccctgtataacctcgtgtctgtctacccggacaagtactgccctctgctgatcaaagaaggggggatgccccttctgagggacataattaagatggcgaccgcacggcaggagaccaaggaaatggcccgcaaggtgattgagcactgcagtaactttaaagaggagaacatggacacgtctagatag
Sequence Length
2301
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
88,169 Da
NCBI Official Full Name
Homo sapiens zer-1 homolog (C. elegans), mRNA
NCBI Official Synonym Full Names
zyg-11 related cell cycle regulator
NCBI Official Symbol
ZER1
NCBI Official Synonym Symbols
ZYG; C9orf60; ZYG11BL
NCBI Protein Information
protein zer-1 homolog
UniProt Protein Name
Protein zer-1 homolog
Protein Family
UniProt Gene Name
ZER1
UniProt Synonym Gene Names
C9orf60; ZYG; ZYG11BL
UniProt Entry Name
ZER1_HUMAN
NCBI Description
This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Uniprot Description
ZYG11BL: Probably acts as target recruitment subunit in the E3 ubiquitin ligase complex ZER1-CUL2-Elongin BC. Belongs to the zyg-11 family.
Protein type: Ubiquitin conjugating system; Ligase
Chromosomal Location of Human Ortholog: 9q34.11
Cellular Component: Cul2-RING ubiquitin ligase complex
Molecular Function: ubiquitin-protein ligase activity
Biological Process: regulation of ubiquitin-protein ligase activity
Similar Products
Product Notes
The ZER1 zer1 (Catalog #AAA1269053) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtccg acactcccga gtcgctgatg gccctctgta ctgacttctg cttgcgcaac ctggatggca ccctgggcta cctgctggac aaggagaccc tgcggctaca tccggacatc ttcttgccca gcgagatctg tgaccggctc gtcaatgagt atgtggagct ggtgaacgct gcctgtaact tcgagccaca cgagagcttc ttcagcctct tttcggaccc ccgcagcacc cgcctcacgc ggatccacct ccgtgaggac ctggtgcagg accaggacct ggaggccatc cgcaagcagg acctggtgga gctgtacctg actaactgcg agaagctgtc cgccaagagc ctgcagacac tgaggagctt cagccacacc ctggtgtcct tgagcctctt cggctgtaca aacattttct atgaggagga gaacccaggg ggctgtgaag atgagtacct cgtcaacccc acctgccagg tgctggttaa ggatttcacc ttcgagggct tcagccgcct ccgcttcctc aacttgggcc gcatgattga ttgggtccct gtggagtccc tgctgcggcc gcttaactcc ctggctgcct tggacctctc aggcattcag acgagcgacg ccgccttcct cacccagtgg aaagacagcc tggtgtccct cgtcctctac aacatggacc tgtccgacga ccacatccgg gtcatcgtgc agctgcacaa gctgcgacac ctggacatct cccgagaccg cctctccagc tactacaagt tcaagctgac tcgggaggtg ctgagcctct ttgtgcagaa gctggggaac ctaatgtccc tggacatctc tggccacatg atcctagaga actgcagcat ctccaagatg gaagaggaag cggggcagac cagcattgag ccttccaaga gcagcatcat acctttccgg gctctgaaga ggccgctgca gttcctcggg ctctttgaga actctctgtg ccgcctcacg cacattccag cctacaaagt aagtggtgac aaaaacgaag agcaggtgct gaatgccatc gaggcctaca cggagcaccg gcctgagatc acctcgcggg ccatcaactt gctttttgac atcgcccgca tcgagcgttg caaccagctg ctgcgggccc tgaagctggt catcacggcc ctcaagtgcc acaaatatga caggaacatt caagtgacag gcagcgccgc tctcttctac ctaacaaatt ccgagtaccg ctcagagcag agtgtgaagc tgcgccggca ggttatccag gtggtgctga atggcatgga atcctaccag gaggtgacgg tgcagcggaa ctgctgcctg acgctctgca acttcagcat ccccgaggag ctggaattcc agtaccgccg ggtcaacgag ctcctgctca gcatcctcaa ccccacgcgg caggacgagt ctatccagcg gatcgccgtg cacctgtgca atgccctggt ctgccaggta gacaacgacc acaaggaggc cgtgggcaag atgggctttg tcgtgaccat gctgaagctg attcagaaga agctgctgga caagacatgt gaccaggtca tggagttctc ctggagtgcc ctgtggaaca tcacagatga aactcctgac aactgcgaga tgttcctcaa tttcaacggc atgaagctct tcctggactg cctgaaggaa ttcccagaga agcaggaact gcataggaat atgctaggac ttttggggaa tgtggcagaa gtgaaggagc tgaggcctca actaatgact tcccagttca tcagcgtctt cagcaacctg ttggagagca aggccgatgg gatcgaggtt tcctacaatg cctgcggcgt cctctcccac atcatgtttg atggacccga ggcctggggc gtctgtgagc cccagcgtga ggaggtggag gaacgcatgt gggctgccat ccagagctgg gacataaact ctcggagaaa catcaattac aggtcatttg aaccaattct ccgcctcctt ccccagggaa tctctcctgt cagccagcac tgggcaacct gggccctgta taacctcgtg tctgtctacc cggacaagta ctgccctctg ctgatcaaag aaggggggat gccccttctg agggacataa ttaagatggc gaccgcacgg caggagacca aggaaatggc ccgcaaggtg attgagcact gcagtaactt taaagaggag aacatggaca cgtctagata g. It is sometimes possible for the material contained within the vial of "ZER1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
