TFB2M cdna clone
TFB2M cDNA Clone
Gene Names
TFB2M; Hkp1; mtTFB2
Synonyms
TFB2M; TFB2M cDNA Clone; TFB2M cdna clone
Sequence
atgtggatcccagtggtcgggcttcctcggcggctgaggctctccgccttggcgggcgctggtcgcttttgcattttagggtctgaagcggcgacgcgaaagcatttgccggcgaggaaccactgtgggctctctgactcctctccgcagctgtggcccgaaccggatttcaggaatccgccaaggaaggcgtctaaggccagcttagactttaagcgttacgtaaccgatcggagattggctgagaccctggcgcaaatctatttgggaaaaccaagtagacctccacacctactgctggagtgcaatccaggtcctggaatcctgactcaggcattacttgaagctggtgccaaagtggttgcgctcgaaagtgacaaaacttttattccacatttggagtccttaggaaaaaatctggatggaaaactacgagtgattcactgtgacttctttaaactagatcctagaagtggtggagtaataaaaccacctgctatgtcttctcgagggctctttaagaatttgggaatagaagcagttccttggacagcagacatccctttaaaagtagttggaatgttcccaagtagaggtgagaaaagggcactttggaaactcgcatatgacttgtattcctgtacttctatatataaatttggacgaatagaagtaaatatgtttattggtgaaaaagaattccagaaactaatggcagatcctggaaatccagacttgtatcatgtattaagtgttatctggcaattagcttgtgagattaaggttctgcacatggagccttggtcatcatttgatatatacacccggaaagggccgctggaaaacccaaagcgtagggaattattagaccaattacaacaaaagctgtatcttattcaaatgattcctcgtcaaaatttatttaccaagaacttaacacctatgaactataatatattttttcacttgttaaagcactgttttgggaggcgcagcgccactgtaatagaccacttacgttcattgactccacttgatgcgagagatatattgatgcaaataggaaaacaggaggatgagaaagtagttaacatgcaccctcaagacttcaaaacactttttgaaactatagagcgttccaaagattgtgcttataaatggctgtatgatgaaaccctggaagataggtag
Sequence Length
1191
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,349 Da
NCBI Official Full Name
Homo sapiens transcription factor B2, mitochondrial, mRNA
NCBI Official Synonym Full Names
transcription factor B2, mitochondrial
NCBI Official Symbol
TFB2M
NCBI Official Synonym Symbols
Hkp1; mtTFB2
NCBI Protein Information
dimethyladenosine transferase 2, mitochondrial
UniProt Protein Name
Dimethyladenosine transferase 2, mitochondrial
Protein Family
UniProt Gene Name
TFB2M
UniProt Synonym Gene Names
NS5ATP5; HCV NS5A-transactivated protein 5; h-mtTFB; h-mtTFB2; hTFB2M; mtTFB2
UniProt Entry Name
TFB2M_HUMAN
Uniprot Description
TFB2M: S-adenosyl-L-methionine-dependent methyltransferase which specifically dimethylates mitochondrial 12S rRNA at the conserved stem loop. Also required for basal transcription of mitochondrial DNA, probably via its interaction with POLRMT and TFAM. Stimulates transcription independently of the methyltransferase activity. Compared to TFB1M, it activates transcription of mitochondrial DNA more efficiently, while it has less methyltransferase activity. Belongs to the methyltransferase superfamily. rRNA adenine N(6)-methyltransferase family. KsgA subfamily.
Protein type: Methyltransferase; Transcription, coactivator/corepressor; EC 2.1.1.-
Chromosomal Location of Human Ortholog: 1q44
Cellular Component: cell junction; mitochondrial matrix; mitochondrion
Molecular Function: rRNA (adenine-N6,N6-)-dimethyltransferase activity; transcription cofactor activity
Biological Process: mitochondrion organization and biogenesis; positive regulation of transcription, DNA-dependent; transcription from mitochondrial promoter; transcription initiation from mitochondrial promoter
Research Articles on TFB2M
Similar Products
Product Notes
The TFB2M tfb2m (Catalog #AAA1268971) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggatcc cagtggtcgg gcttcctcgg cggctgaggc tctccgcctt ggcgggcgct ggtcgctttt gcattttagg gtctgaagcg gcgacgcgaa agcatttgcc ggcgaggaac cactgtgggc tctctgactc ctctccgcag ctgtggcccg aaccggattt caggaatccg ccaaggaagg cgtctaaggc cagcttagac tttaagcgtt acgtaaccga tcggagattg gctgagaccc tggcgcaaat ctatttggga aaaccaagta gacctccaca cctactgctg gagtgcaatc caggtcctgg aatcctgact caggcattac ttgaagctgg tgccaaagtg gttgcgctcg aaagtgacaa aacttttatt ccacatttgg agtccttagg aaaaaatctg gatggaaaac tacgagtgat tcactgtgac ttctttaaac tagatcctag aagtggtgga gtaataaaac cacctgctat gtcttctcga gggctcttta agaatttggg aatagaagca gttccttgga cagcagacat ccctttaaaa gtagttggaa tgttcccaag tagaggtgag aaaagggcac tttggaaact cgcatatgac ttgtattcct gtacttctat atataaattt ggacgaatag aagtaaatat gtttattggt gaaaaagaat tccagaaact aatggcagat cctggaaatc cagacttgta tcatgtatta agtgttatct ggcaattagc ttgtgagatt aaggttctgc acatggagcc ttggtcatca tttgatatat acacccggaa agggccgctg gaaaacccaa agcgtaggga attattagac caattacaac aaaagctgta tcttattcaa atgattcctc gtcaaaattt atttaccaag aacttaacac ctatgaacta taatatattt tttcacttgt taaagcactg ttttgggagg cgcagcgcca ctgtaataga ccacttacgt tcattgactc cacttgatgc gagagatata ttgatgcaaa taggaaaaca ggaggatgag aaagtagtta acatgcaccc tcaagacttc aaaacacttt ttgaaactat agagcgttcc aaagattgtg cttataaatg gctgtatgat gaaaccctgg aagataggta g. It is sometimes possible for the material contained within the vial of "TFB2M, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
