Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NAB2 cdna clone

NAB2 cDNA Clone

Gene Names
NAB2; MADER
Synonyms
NAB2; NAB2 cDNA Clone; NAB2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcacagagcgccttcccccacagccgagcagccgccgggcggaggggacagcgcccgccggaccctgcagcccagactcaagcccagtgcccgagccatggcactgcctcggacgctgggggagctgcagctgtaccgggtcctgcagcgcgccaacctcctttcctactatgagaccttcatccagcagggaggggacgacgtgcagcagctgtgtgaggcgggtgaggaggagtttctggagatcatggcacttgtgggcatggccaccaagcccctccatgtccggcgcctgcagaaggcactgagagagtgggccaccaatccagggctcttcagtcaaccagtgcctgctgttcccgtctccagcatcccgctcttcaagatctctgagactgcgggtacccggaaagggagcatgagcaatgggcatggcagcccaggggaaaaggcaggcagtgcccgcagttttagccccaagagcccccttgaacttggagagaagctatcaccactgcctgggggacctggggcaggggacccccggatctggccaggccggagcactccagagtcggacgttggggcaggaggagaagaggaggctggcagcaggtgggactgggggtggtccagaccgactggagccagagatggtacgccagcctgtctggggagagtctggatggacatttgcaggctgtggggtcatgtccaaggctga
Sequence Length
726
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,748 Da
NCBI Official Full Name
Homo sapiens NGFI-A binding protein 2 (EGR1 binding protein 2), mRNA
NCBI Official Synonym Full Names
NGFI-A binding protein 2
NCBI Official Symbol
NAB2
NCBI Official Synonym Symbols
MADER
NCBI Protein Information
NGFI-A-binding protein 2
UniProt Protein Name
NGFI-A-binding protein 2
Protein Family
UniProt Gene Name
NAB2
UniProt Synonym Gene Names
MADER; Protein MADER
UniProt Entry Name
NAB2_HUMAN

NCBI Description

This gene encodes a member of the family of NGFI-A binding (NAB) proteins, which function in the nucleus to repress transcription induced by some members of the EGR (early growth response) family of transactivators. NAB proteins can homo- or hetero-multimerize with other EGR or NAB proteins through a conserved N-terminal domain, and repress transcription through two partially redundant C-terminal domains. Transcriptional repression by the encoded protein is mediated in part by interactions with the nucleosome remodeling and deactylase (NuRD) complex. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

NAB2: Acts as a transcriptional repressor for zinc finger transcription factors EGR1 and EGR2. Isoform 2 lacks repression ability. Belongs to the NAB family. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 12q13.3

Cellular Component: nucleus

Molecular Function: protein binding; transcription corepressor activity

Biological Process: cell proliferation; negative regulation of transcription from RNA polymerase III promoter; nervous system development

Research Articles on NAB2

Similar Products

Product Notes

The NAB2 nab2 (Catalog #AAA1268958) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacagag cgccttcccc cacagccgag cagccgccgg gcggagggga cagcgcccgc cggaccctgc agcccagact caagcccagt gcccgagcca tggcactgcc tcggacgctg ggggagctgc agctgtaccg ggtcctgcag cgcgccaacc tcctttccta ctatgagacc ttcatccagc agggagggga cgacgtgcag cagctgtgtg aggcgggtga ggaggagttt ctggagatca tggcacttgt gggcatggcc accaagcccc tccatgtccg gcgcctgcag aaggcactga gagagtgggc caccaatcca gggctcttca gtcaaccagt gcctgctgtt cccgtctcca gcatcccgct cttcaagatc tctgagactg cgggtacccg gaaagggagc atgagcaatg ggcatggcag cccaggggaa aaggcaggca gtgcccgcag ttttagcccc aagagccccc ttgaacttgg agagaagcta tcaccactgc ctgggggacc tggggcaggg gacccccgga tctggccagg ccggagcact ccagagtcgg acgttggggc aggaggagaa gaggaggctg gcagcaggtg ggactggggg tggtccagac cgactggagc cagagatggt acgccagcct gtctggggag agtctggatg gacatttgca ggctgtgggg tcatgtccaa ggctga. It is sometimes possible for the material contained within the vial of "NAB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.