Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BNIP3L cdna clone

BNIP3L cDNA Clone

Gene Names
BNIP3L; NIX; BNIP3a
Synonyms
BNIP3L; BNIP3L cDNA Clone; BNIP3L cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgtcccacctagtcgagccgccgccgcccctgcacaacaacaacaacaactgcgaggaaaatgagcagtctctgcccccgccggccggcctcaacagttcctgggtggagctacccatgaacagcagcaatggcaatgataatggcaatgggaaaaatggggggctggaacacgtaccatcctcatcctccatccacaatggagacatggagaagattcttttggatgcacaacatgaatcaggacagagtagttccagaggcagttctcactgtgacagcccttcgccacaagaagatgggcagatcatgtttgatgtggaaatgcacaccagcagggaccatagctctcagtcagaagaagaagttgtagaaggagagaaggaagtcgaggctttgaagaaaagtgcggactgggtatcagactggtccagtagacccgaaaacattccacccaaggagttccacttcagacaccctaaacgttctgtgtctttaagcatgaggaaaagtggagccatgaagaaagggggtattttctccgcagaatttctgaaggtgttcattccatctctcttcctttctcatgttttggctttggggctaggcatctatattggaaagcgactgagcacaccctctgccagcacctactga
Sequence Length
660
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
665
Molecular Weight
19,559 Da
NCBI Official Full Name
Homo sapiens BCL2/adenovirus E1B 19kDa interacting protein 3-like, mRNA
NCBI Official Synonym Full Names
BCL2 interacting protein 3 like
NCBI Official Symbol
BNIP3L
NCBI Official Synonym Symbols
NIX; BNIP3a
NCBI Protein Information
BCL2/adenovirus E1B 19 kDa protein-interacting protein 3-like
UniProt Protein Name
BCL2/adenovirus E1B 19 kDa protein-interacting protein 3-like
UniProt Gene Name
BNIP3L
UniProt Synonym Gene Names
BNIP3A; BNIP3H; NIX; NIP3L
UniProt Entry Name
BNI3L_HUMAN

NCBI Description

This gene encodes a protein that belongs to the pro-apoptotic subfamily within the Bcl-2 family of proteins. The encoded protein binds to Bcl-2 and possesses the BH3 domain. The protein directly targets mitochondria and causes apoptotic changes, including loss of membrane potential and the release of cytochrome c. [provided by RefSeq, Feb 2015]

Uniprot Description

BNIP3L: Induces apoptosis. Interacts with viral and cellular anti-apoptosis proteins. Can overcome the suppressors BCL-2 and BCL-XL, although high levels of BCL-XL expression will inhibit apoptosis. Inhibits apoptosis induced by BNIP3. Involved in mitochondrial quality control via its interaction with SPATA18/MIEAP: in response to mitochondrial damage, participates to mitochondrial protein catabolic process (also named MALM) leading to the degradation of damaged proteins inside mitochondria. May function as a tumor suppressor. Self-associates. Interacts with BNIP3 and STEAP3. Interacts with SPATA18/MIEAP. Interacts with human adenovirus-2 E1B 19 kDa protein. Belongs to the NIP3 family.

Protein type: Membrane protein, integral; Mitochondrial; Nuclear envelope; Apoptosis; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 8p21

Cellular Component: endoplasmic reticulum; intrinsic to membrane; mitochondrial outer membrane; mitochondrion; nuclear envelope

Molecular Function: identical protein binding; lamin binding; protein binding; protein heterodimerization activity; protein homodimerization activity

Biological Process: defense response to virus; negative regulation of apoptosis; positive regulation of apoptosis; positive regulation of macroautophagy; regulation of apoptosis

Research Articles on BNIP3L

Similar Products

Product Notes

The BNIP3L bnip3l (Catalog #AAA1268894) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgtccc acctagtcga gccgccgccg cccctgcaca acaacaacaa caactgcgag gaaaatgagc agtctctgcc cccgccggcc ggcctcaaca gttcctgggt ggagctaccc atgaacagca gcaatggcaa tgataatggc aatgggaaaa atggggggct ggaacacgta ccatcctcat cctccatcca caatggagac atggagaaga ttcttttgga tgcacaacat gaatcaggac agagtagttc cagaggcagt tctcactgtg acagcccttc gccacaagaa gatgggcaga tcatgtttga tgtggaaatg cacaccagca gggaccatag ctctcagtca gaagaagaag ttgtagaagg agagaaggaa gtcgaggctt tgaagaaaag tgcggactgg gtatcagact ggtccagtag acccgaaaac attccaccca aggagttcca cttcagacac cctaaacgtt ctgtgtcttt aagcatgagg aaaagtggag ccatgaagaa agggggtatt ttctccgcag aatttctgaa ggtgttcatt ccatctctct tcctttctca tgttttggct ttggggctag gcatctatat tggaaagcga ctgagcacac cctctgccag cacctactga. It is sometimes possible for the material contained within the vial of "BNIP3L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.