Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SRFBP1 cdna clone

SRFBP1 cDNA Clone

Gene Names
SRFBP1; P49; Rlb1; BUD22; STRAP; p49/STRAP
Synonyms
SRFBP1; SRFBP1 cDNA Clone; SRFBP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctcagccgggaactctgaacctcaataacgaggttgtgaagatgagaaaagaagtgaagagaattcgagttttagttatccgaaaacttgtcaggagtgttggccgactgaagtcaaaaaagggtactgaagatgcactgttaaaaaaccaaagacgggcgcaaagattgcttgaagaaatccatgccatgaaggaattgaaacctgacatagtaactaaatctgctcttggtgatgatatcaactttgaaaaaatcttcaaaaagccagattctactgcaactgaaagagcaattgccagactagcagtacatcctcttctgaagaaaaagatagatgtgctaaaagctgctgtacaagcctttaaagaagcaagacaaaatgttgctgaagttgagtcatcaaagaatgcttcagaggacaatcattctgagaatactttgtattcaaatgataatggaagtaatttacagcgtgaagcaactgtcatcagtgagcaaaaagtcaaagaaaccaaaatattggcgaagaaaccaatacataattcaaaggaaaaaatagcaaagatggaacatggacctaaagcagtgactattgcaaattctccatcaaagccttcagaaaaggattctgtagtttcccttgagtcccagaagacacctgctgacccaaaactgaaaactctaagtcaaaccaaaaaaaacaaaggatctgatagctcactctctggtaacagtgatggcggagaagaattttgtgaagaggagaaggaatattttgatgatagcacagaagaaaggttttacaagcagtcttccatgtctgaagatagtgatagcggtgacgacttcttcattgggaaagtcagacggacacgaaagaaggaaagtagttgtcattcttcagttaaggaacaaaaaccactagaaaaagtgtttcttaaagaagatacaggtgaaactcatggggatacaagaaatgacaaaatcaagccaagtacagaaaccagaaagttagaatcagtgtttttccactctttatctggatctaaaagctctagaagaaatttcaaagaacaggctccaaaaacaagatccctagattttccacagaatgagcctcagatcaagaatcagtttaataagaagctatcaggaagacttgaaaatacaaaacagcaattgcagctgcctcttcatccttcatgggaagcaagcagaaggcgaaaagaacagcaatctaatattgctgtgtttcaggggaaaaaaattacgtttgatgattga
Sequence Length
1290
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,634 Da
NCBI Official Full Name
Homo sapiens serum response factor binding protein 1, mRNA
NCBI Official Synonym Full Names
serum response factor binding protein 1
NCBI Official Symbol
SRFBP1
NCBI Official Synonym Symbols
P49; Rlb1; BUD22; STRAP; p49/STRAP
NCBI Protein Information
serum response factor-binding protein 1
UniProt Protein Name
Serum response factor-binding protein 1
UniProt Gene Name
SRFBP1
UniProt Entry Name
SRFB1_HUMAN

Uniprot Description

SRFBP1: May be involved in regulating transcriptional activation of cardiac genes during the aging process. May play a role in biosynthesis and/or processing of SLC2A4 in adipose cells.

Protein type: RNA-binding; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 5q23.1

Cellular Component: nucleus

Biological Process: maturation of SSU-rRNA

Research Articles on SRFBP1

Similar Products

Product Notes

The SRFBP1 srfbp1 (Catalog #AAA1268859) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcagc cgggaactct gaacctcaat aacgaggttg tgaagatgag aaaagaagtg aagagaattc gagttttagt tatccgaaaa cttgtcagga gtgttggccg actgaagtca aaaaagggta ctgaagatgc actgttaaaa aaccaaagac gggcgcaaag attgcttgaa gaaatccatg ccatgaagga attgaaacct gacatagtaa ctaaatctgc tcttggtgat gatatcaact ttgaaaaaat cttcaaaaag ccagattcta ctgcaactga aagagcaatt gccagactag cagtacatcc tcttctgaag aaaaagatag atgtgctaaa agctgctgta caagccttta aagaagcaag acaaaatgtt gctgaagttg agtcatcaaa gaatgcttca gaggacaatc attctgagaa tactttgtat tcaaatgata atggaagtaa tttacagcgt gaagcaactg tcatcagtga gcaaaaagtc aaagaaacca aaatattggc gaagaaacca atacataatt caaaggaaaa aatagcaaag atggaacatg gacctaaagc agtgactatt gcaaattctc catcaaagcc ttcagaaaag gattctgtag tttcccttga gtcccagaag acacctgctg acccaaaact gaaaactcta agtcaaacca aaaaaaacaa aggatctgat agctcactct ctggtaacag tgatggcgga gaagaatttt gtgaagagga gaaggaatat tttgatgata gcacagaaga aaggttttac aagcagtctt ccatgtctga agatagtgat agcggtgacg acttcttcat tgggaaagtc agacggacac gaaagaagga aagtagttgt cattcttcag ttaaggaaca aaaaccacta gaaaaagtgt ttcttaaaga agatacaggt gaaactcatg gggatacaag aaatgacaaa atcaagccaa gtacagaaac cagaaagtta gaatcagtgt ttttccactc tttatctgga tctaaaagct ctagaagaaa tttcaaagaa caggctccaa aaacaagatc cctagatttt ccacagaatg agcctcagat caagaatcag tttaataaga agctatcagg aagacttgaa aatacaaaac agcaattgca gctgcctctt catccttcat gggaagcaag cagaaggcga aaagaacagc aatctaatat tgctgtgttt caggggaaaa aaattacgtt tgatgattga. It is sometimes possible for the material contained within the vial of "SRFBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.