SRFBP1 cdna clone

SRFBP1 cDNA Clone

Gene Names

SRFBP1; P49; Rlb1; BUD22; STRAP; p49/STRAP

Synonyms

SRFBP1; SRFBP1 cDNA Clone; SRFBP1 cdna clone

Ordering
Cat. Num. AAA1268859 For Research Use Only!

Sequence

atggctcagccgggaactctgaacctcaataacgaggttgtgaagatgagaaaagaagtgaagagaattcgagttttagttatccgaaaacttgtcaggagtgttggccgactgaagtcaaaaaagggtactgaagatgcactgttaaaaaaccaaagacgggcgcaaagattgcttgaagaaatccatgccatgaaggaattgaaacctgacatagtaactaaatctgctcttggtgatgatatcaactttgaaaaaatcttcaaaaagccagattctactgcaactgaaagagcaattgccagactagcagtacatcctcttctgaagaaaaagatagatgtgctaaaagctgctgtacaagcctttaaagaagcaagacaaaatgttgctgaagttgagtcatcaaagaatgcttcagaggacaatcattctgagaatactttgtattcaaatgataatggaagtaatttacagcgtgaagcaactgtcatcagtgagcaaaaagtcaaagaaaccaaaatattggcgaagaaaccaatacataattcaaaggaaaaaatagcaaagatggaacatggacctaaagcagtgactattgcaaattctccatcaaagccttcagaaaaggattctgtagtttcccttgagtcccagaagacacctgctgacccaaaactgaaaactctaagtcaaaccaaaaaaaacaaaggatctgatagctcactctctggtaacagtgatggcggagaagaattttgtgaagaggagaaggaatattttgatgatagcacagaagaaaggttttacaagcagtcttccatgtctgaagatagtgatagcggtgacgacttcttcattgggaaagtcagacggacacgaaagaaggaaagtagttgtcattcttcagttaaggaacaaaaaccactagaaaaagtgtttcttaaagaagatacaggtgaaactcatggggatacaagaaatgacaaaatcaagccaagtacagaaaccagaaagttagaatcagtgtttttccactctttatctggatctaaaagctctagaagaaatttcaaagaacaggctccaaaaacaagatccctagattttccacagaatgagcctcagatcaagaatcagtttaataagaagctatcaggaagacttgaaaatacaaaacagcaattgcagctgcctcttcatccttcatgggaagcaagcagaaggcgaaaagaacagcaatctaatattgctgtgtttcaggggaaaaaaattacgtttgatgattga

Sequence Length

1290

Vector

pENTR223.1

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

21410698

NCBI GeneID

153443

Molecular Weight

48,634 Da

NCBI Official Full Name

Homo sapiens serum response factor binding protein 1, mRNA

NCBI Official Synonym Full Names

serum response factor binding protein 1

NCBI Official Symbol

SRFBP1

NCBI Official Synonym Symbols

P49; Rlb1; BUD22; STRAP; p49/STRAP

NCBI Protein Information

serum response factor-binding protein 1

UniProt Protein Name

Serum response factor-binding protein 1

Protein Family

Serum response factor-binding protein

UniProt Gene Name

SRFBP1

UniProt Entry Name

SRFB1_HUMAN

Uniprot Description

SRFBP1: May be involved in regulating transcriptional activation of cardiac genes during the aging process. May play a role in biosynthesis and/or processing of SLC2A4 in adipose cells.

Protein type: RNA-binding; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 5q23.1

Cellular Component: nucleus

Biological Process: maturation of SSU-rRNA

Research Articles on SRFBP1

1. SRFBP1 is an HCV-specific, pan-genotypic host entry factor.

Similar Products

Product Notes

The SRFBP1 srfbp1 (Catalog #AAA1268859) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcagc cgggaactct gaacctcaat aacgaggttg tgaagatgag aaaagaagtg aagagaattc gagttttagt tatccgaaaa cttgtcagga gtgttggccg actgaagtca aaaaagggta ctgaagatgc actgttaaaa aaccaaagac gggcgcaaag attgcttgaa gaaatccatg ccatgaagga attgaaacct gacatagtaa ctaaatctgc tcttggtgat gatatcaact ttgaaaaaat cttcaaaaag ccagattcta ctgcaactga aagagcaatt gccagactag cagtacatcc tcttctgaag aaaaagatag atgtgctaaa agctgctgta caagccttta aagaagcaag acaaaatgtt gctgaagttg agtcatcaaa gaatgcttca gaggacaatc attctgagaa tactttgtat tcaaatgata atggaagtaa tttacagcgt gaagcaactg tcatcagtga gcaaaaagtc aaagaaacca aaatattggc gaagaaacca atacataatt caaaggaaaa aatagcaaag atggaacatg gacctaaagc agtgactatt gcaaattctc catcaaagcc ttcagaaaag gattctgtag tttcccttga gtcccagaag acacctgctg acccaaaact gaaaactcta agtcaaacca aaaaaaacaa aggatctgat agctcactct ctggtaacag tgatggcgga gaagaatttt gtgaagagga gaaggaatat tttgatgata gcacagaaga aaggttttac aagcagtctt ccatgtctga agatagtgat agcggtgacg acttcttcat tgggaaagtc agacggacac gaaagaagga aagtagttgt cattcttcag ttaaggaaca aaaaccacta gaaaaagtgt ttcttaaaga agatacaggt gaaactcatg gggatacaag aaatgacaaa atcaagccaa gtacagaaac cagaaagtta gaatcagtgt ttttccactc tttatctgga tctaaaagct ctagaagaaa tttcaaagaa caggctccaa aaacaagatc cctagatttt ccacagaatg agcctcagat caagaatcag tttaataaga agctatcagg aagacttgaa aatacaaaac agcaattgca gctgcctctt catccttcat gggaagcaag cagaaggcga aaagaacagc aatctaatat tgctgtgttt caggggaaaa aaattacgtt tgatgattga. It is sometimes possible for the material contained within the vial of "SRFBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

SRFBP1 cdna clone