Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RABL2A cdna clone

RABL2A cDNA Clone

Synonyms
RABL2A; RABL2A cDNA Clone; RABL2A cdna clone
Ordering
For Research Use Only!
Sequence
atggcagaagacaaaaccaaaccgagtgagttggaccaagggaagtatgatgctgatgacaacgtgaagatcatctgcctgggagacagcgcagtgggcaaatccaaactcatggagagatttctcatggatggctttcagccacagcagctgtccacgtacgccctgaccctgtacaagcacacagccacggtagatggcaagaccatccttgtggacttttgggacacggcaggccaggagcggttccagagcatgcatgcctcctactaccacaaggcccatgcctgcatcatggtgtttgatatacagaggaaagtcacctataggaacctgagcacctggtatacagagcttcgggagttcaggccagagatcccatgcatcgtggtggccaataaaattgatgcagacataaacgtgacccaaaaaagcttcaattttgccaagaagttctccctgcccctgtatttcgtctcggctgctgatggtaccaatgttgtgaagctcttcaatgatgcaattcgattagctgtgtcttacaaacagaactcccaggacttcatggatgagatttttcaggagctcgagaacttcagcttggagcaggaagaggaggacgtgccagaccaggaacagagcagcagcatcgagaccccatcagaggaggaatag
Sequence Length
675
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,201 Da
NCBI Official Full Name
Homo sapiens RAB, member of RAS oncogene family-like 2A, mRNA
NCBI Official Synonym Full Names
RAB, member of RAS oncogene family-like 2A
NCBI Official Symbol
RABL2A
NCBI Protein Information
rab-like protein 2A
UniProt Protein Name
Rab-like protein 2A
UniProt Gene Name
RABL2A
UniProt Entry Name
RBL2A_HUMAN

NCBI Description

This gene is a member of the RAB gene family which belongs to the RAS GTPase superfamily. The proteins in the family of RAS-related signaling molecules are small GTP-binding proteins that play important roles in the regulation of exocytotic and endocytotic pathways. This gene maps to the site of an ancestral telomere fusion event and may be a subtelomeric gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]

Uniprot Description

RABL2A: a member of the RAB gene family which belongs to the RAS GTPase superfamily. The proteins in the family of RAS-related signaling molecules are small GTP-binding proteins that play important roles in the regulation of exocytotic and endocytotic pathways. This gene maps to the site of an ancestral telomere fusion event and may be a subtelomeric gene. Two alternatively spliced transcript variants have been identified, both encoding the same protein. [provided by RefSeq, Jul 2008]

Protein type: G protein, monomeric; G protein; G protein, monomeric, Rab

Chromosomal Location of Human Ortholog: 2q13

Molecular Function: GTPase activity

Research Articles on RABL2A

Similar Products

Product Notes

The RABL2A rabl2a (Catalog #AAA1268848) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaag acaaaaccaa accgagtgag ttggaccaag ggaagtatga tgctgatgac aacgtgaaga tcatctgcct gggagacagc gcagtgggca aatccaaact catggagaga tttctcatgg atggctttca gccacagcag ctgtccacgt acgccctgac cctgtacaag cacacagcca cggtagatgg caagaccatc cttgtggact tttgggacac ggcaggccag gagcggttcc agagcatgca tgcctcctac taccacaagg cccatgcctg catcatggtg tttgatatac agaggaaagt cacctatagg aacctgagca cctggtatac agagcttcgg gagttcaggc cagagatccc atgcatcgtg gtggccaata aaattgatgc agacataaac gtgacccaaa aaagcttcaa ttttgccaag aagttctccc tgcccctgta tttcgtctcg gctgctgatg gtaccaatgt tgtgaagctc ttcaatgatg caattcgatt agctgtgtct tacaaacaga actcccagga cttcatggat gagatttttc aggagctcga gaacttcagc ttggagcagg aagaggagga cgtgccagac caggaacaga gcagcagcat cgagacccca tcagaggagg aatag. It is sometimes possible for the material contained within the vial of "RABL2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.