ACAD9 cdna clone
ACAD9 cDNA Clone
Gene Names
ACAD9; NPD002
Synonyms
ACAD9; ACAD9 cDNA Clone; ACAD9 cdna clone
Sequence
atgagcggctgcgggctcttcctgcgcaccacggctgcggctcgtgcctgccggggtctggtggtctctaccgcgaaccggcggctactgcgcaccagcccgcctgtacgagctttcgccaaagagcttttcctaggcaaaatcaagaagaaagaagttttcccatttccagaagttagccaagatgaacttaatgaaatcaatcagttcttgggacccgtggaaaaattcttcactgaagaggtggactcccgaaaaattgaccaggaagggaaaatcccagatgaaactttggagaaattgaagagcctagggctttttgggctgcaagtcccagaagaatatggtggcctgggcttctccaacaccatgtactcacgactaggggagatcatcagcatggatgggtccatcactgtgaccctggcagcgcaccaggctattggcctcaaggggatcatcttggctggcactgaggagcagaaagccaaatacttgcctaaactggcgtccggggagcacattgcagccttctgcctcacggagccagccagtgggagcgatgcagcctcaatccggagcagagccacactaagtgaagacaagaagcactacatcctcaatggctccaaggtctggattactaatggaggactggccaatatttttactgtgtttgcaaagactgaggtcgttgattctgatggatcagtgaaagacaaaatcacagcattcatagtagaaagagactttggtggagtcactaatgggaaacccgaagataaattaggcattcggggctccaacacttgtgaagtccattttgaaaacaccaagatacctgtggaaaacatccttggagaggtcggagatgggtttaaggtggccatgaacatcctcaacagcggccggttcagcatgggcagcgtcgtggctgggctgctcaagagattgattgaaatgactgctgagtacgcctgcacaaggaaacagtttaacaagaggctcagtgaatttggattgattcaggagaaatttgcactgatggctcagaaggcttacgtcatggagagtatgacctacctcacagcagggatgctggaccaacctggctttcccgactgctccatcgaggcagccatggtgaaggtgttcagctccgaggccgcctggcagtgtgtgagtgaggcgctgcagatcctcgggggcttgggctacacaagggactatccgtacgagcgcatactgcgtgacacccgcatcctcctcatcttcgagggaaccaatgagattctccggatgtacatcgccctgacgggtctgcagcatgccggccgcatcctgactaccaggatccatgagcttaaacaggccaaagtgagcacagtcatggataccgttggccggaggcttcgggactccctgggccgaactgtggacctggggctgacaggcaaccatggagttgtgcaccctagtcttgcggacagtgccaacaagtttgaggagaacacctactgcttcggccggaccgtggagacactgctgctccgctttggcaagaccatcatggaggagcagctggtactgaagcgggtggccaacatcctcatcaacctgtatggcatgacggccgtgctgtcgcgggccagccgctccatccgcattgggctccgcaaccacgaccacgaggttctcttggccaacaccttctgcgtggaagcttacttgcagaatctcttcagcctctctcagctggacaagtatgctccagaaaacctagatgagcagattaagaaagtgtcccagcagatccttgagaagcgagcctatatctgtgcccaccctctggacaggacatgctga
Sequence Length
1866
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
68,760 Da
NCBI Official Full Name
Homo sapiens acyl-Coenzyme A dehydrogenase family, member 9, mRNA
NCBI Official Synonym Full Names
acyl-CoA dehydrogenase family member 9
NCBI Official Symbol
ACAD9
NCBI Official Synonym Symbols
NPD002
NCBI Protein Information
acyl-CoA dehydrogenase family member 9, mitochondrial
UniProt Protein Name
Acyl-CoA dehydrogenase family member 9, mitochondrial
Protein Family
UniProt Gene Name
ACAD9
UniProt Synonym Gene Names
ACAD-9
UniProt Entry Name
ACAD9_HUMAN
NCBI Description
This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Uniprot Description
ACAD9: Has a dehydrogenase activity on palmitoyl-CoA (C16:0) and stearoyl-CoA (C18:0). It is three times more active on palmitoyl-CoA then on stearoyl-CoA. Has little activity on octanoyl-CoA (C8:0), butyryl-CoA (C4:0) or isovaleryl-CoA (5:0). Belongs to the acyl-CoA dehydrogenase family.
Protein type: Oxidoreductase; Mitochondrial; EC 1.3.99.-
Chromosomal Location of Human Ortholog: 3q21.3
Cellular Component: dendrite; mitochondrial inner membrane; mitochondrion; nucleus
Molecular Function: acyl-CoA binding; acyl-CoA dehydrogenase activity; electron carrier activity; FAD binding; protein binding
Biological Process: fatty acid beta-oxidation using acyl-CoA dehydrogenase; lipid homeostasis; mitochondrial respiratory chain complex I assembly
Disease: Acyl-coa Dehydrogenase Family, Member 9, Deficiency Of
Research Articles on ACAD9
Similar Products
Product Notes
The ACAD9 acad9 (Catalog #AAA1268822) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcggct gcgggctctt cctgcgcacc acggctgcgg ctcgtgcctg ccggggtctg gtggtctcta ccgcgaaccg gcggctactg cgcaccagcc cgcctgtacg agctttcgcc aaagagcttt tcctaggcaa aatcaagaag aaagaagttt tcccatttcc agaagttagc caagatgaac ttaatgaaat caatcagttc ttgggacccg tggaaaaatt cttcactgaa gaggtggact cccgaaaaat tgaccaggaa gggaaaatcc cagatgaaac tttggagaaa ttgaagagcc tagggctttt tgggctgcaa gtcccagaag aatatggtgg cctgggcttc tccaacacca tgtactcacg actaggggag atcatcagca tggatgggtc catcactgtg accctggcag cgcaccaggc tattggcctc aaggggatca tcttggctgg cactgaggag cagaaagcca aatacttgcc taaactggcg tccggggagc acattgcagc cttctgcctc acggagccag ccagtgggag cgatgcagcc tcaatccgga gcagagccac actaagtgaa gacaagaagc actacatcct caatggctcc aaggtctgga ttactaatgg aggactggcc aatattttta ctgtgtttgc aaagactgag gtcgttgatt ctgatggatc agtgaaagac aaaatcacag cattcatagt agaaagagac tttggtggag tcactaatgg gaaacccgaa gataaattag gcattcgggg ctccaacact tgtgaagtcc attttgaaaa caccaagata cctgtggaaa acatccttgg agaggtcgga gatgggttta aggtggccat gaacatcctc aacagcggcc ggttcagcat gggcagcgtc gtggctgggc tgctcaagag attgattgaa atgactgctg agtacgcctg cacaaggaaa cagtttaaca agaggctcag tgaatttgga ttgattcagg agaaatttgc actgatggct cagaaggctt acgtcatgga gagtatgacc tacctcacag cagggatgct ggaccaacct ggctttcccg actgctccat cgaggcagcc atggtgaagg tgttcagctc cgaggccgcc tggcagtgtg tgagtgaggc gctgcagatc ctcgggggct tgggctacac aagggactat ccgtacgagc gcatactgcg tgacacccgc atcctcctca tcttcgaggg aaccaatgag attctccgga tgtacatcgc cctgacgggt ctgcagcatg ccggccgcat cctgactacc aggatccatg agcttaaaca ggccaaagtg agcacagtca tggataccgt tggccggagg cttcgggact ccctgggccg aactgtggac ctggggctga caggcaacca tggagttgtg caccctagtc ttgcggacag tgccaacaag tttgaggaga acacctactg cttcggccgg accgtggaga cactgctgct ccgctttggc aagaccatca tggaggagca gctggtactg aagcgggtgg ccaacatcct catcaacctg tatggcatga cggccgtgct gtcgcgggcc agccgctcca tccgcattgg gctccgcaac cacgaccacg aggttctctt ggccaacacc ttctgcgtgg aagcttactt gcagaatctc ttcagcctct ctcagctgga caagtatgct ccagaaaacc tagatgagca gattaagaaa gtgtcccagc agatccttga gaagcgagcc tatatctgtg cccaccctct ggacaggaca tgctga. It is sometimes possible for the material contained within the vial of "ACAD9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
