Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HLCS cdna clone

HLCS cDNA Clone

Gene Names
HLCS; HCS
Synonyms
HLCS; HLCS cDNA Clone; HLCS cdna clone
Ordering
For Research Use Only!
Sequence
atggaagatagactccacatggataatggactggtaccccaaaagattgtgtcggtgcacttgcaggactccactctgaaggaagttaaggatcaggtctcaaacaagcaagcccagatcctagagccgaagcctgaaccttctcttgagattaagcctgagcaggacggtatggagcatgttggcagagatgacccaaaggctcttggtgaagaacccaaacaaaggagaggcagtgcctctgggagtgagcctgctggggacagtgacaggggagggggccccgttgagcattatcacctccatctgtctagttgccacgagtgtctggaacttgagaacagcaccattgagtcagtcaagtttgcgtctgccgagaacattccagaccttccctacgattatagcagcagtttggagagtgttgctgatgagacctcccccgaaagagaagggaggagagtcaacctcacgggaaaggcacccaacatcctcctctatgtgggctccgactcccaggaagccctcggccggttccacgaggtccggtctgtgctggccgactgtgtggacattgacagttatattctctaccacctgctggaggacagtgctctcagagacccgtggacggacaactgtctgctgttggtcattgctaccagggagtccattcccgaagacctgtaccagaagttcatggcctatctttctcagggagggaaggtgttgggcctgtcttcatccttcacctttggtggctttcaggtgacaagcaagggtgcactgcacaagacagtccagaacttggttttctccaaggctgaccagagtgaggtgaagctcagcgtcttgagcagtggctgcaggtaccaggaaggccccgtccggctcagccccggcaggctccagggccacctggagaatgaggacaaggacaggatgattgtgcatgtgccttttggaactcgcgggggagaagctgttctttgccaggtgcacttagaactacctcccagctccaacatagtgcaaactccagaagattttaacttgctcaagtcaagcaattttagaagatacgaagtccttagagagattctgacaacccttggcctcagctgtgacatgaaacaagttcctgccttaactcctctttacttgctgtcagctgcggaggaaatcagggatcctcttatgcagtggcttgggaaacatgtggactccgagggagaaataaaatccggccagctctctcttagatttgtttcatcctacgtgtctgaagtagaaataaccccatcttgtatacctgtggtgaccaacatggaggccttctcatcagaacatttcaacttagagatctatcgccaaaatctgcagaccaagcagttggggaaagtaattttgtttgccgaagtgacccccacaacgatgcgtctcctggatgggctgatgtttcagacaccgcaggaaatgggcttaatagtgatcgcggcccggcagaccgagggcaaaggacggggagggaatgtgtggctgagccctgtgggatgtgctctttctactctgctcatctccattccactgagatcccagctgggacagaggatcccgtttgtccagcatctgatgtccgtggctgtcgtggaagcagtgaggtccattcccgagtatcaggatatcaacttacgagtgaagtggcccaacgatatttattacagtgacctcatgaagatcggcggagttctggttaactcaacactcatgggagaaacattttatatacttattggctgtggatttaatgtgactaacagtaaccctaccatctgcatcaacgacctcatcacagaatacaataaacaacacaaggcagaactgaagcccttaagagccgattatctcatcgccagagtcgtgactgtgctggagaaactgatcaaagagtttcaggacaaagggcccaacagcgtccttcccctttattaccgatactgggtccacagtggtcagcaagtccatctgggcagcgcagagggaccaaaggtgtccatcgttggcctggacgattctggcttcctccaggttcaccaggagggcggcgaggttgtgactgtgcacccggacggcaactccttcgacatgctgagaaacctcatcctccccaaacggcggtaa
Sequence Length
2181
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
80,760 Da
NCBI Official Full Name
Homo sapiens holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase), mRNA
NCBI Official Synonym Full Names
holocarboxylase synthetase
NCBI Official Symbol
HLCS
NCBI Official Synonym Symbols
HCS
NCBI Protein Information
biotin--protein ligase
UniProt Protein Name
Biotin--protein ligase
Protein Family
UniProt Gene Name
HLCS
UniProt Synonym Gene Names
HCS
UniProt Entry Name
BPL1_HUMAN

NCBI Description

This gene encodes an enzyme that catalyzes the binding of biotin to carboxylases and histones. The protein plays an important role in gluconeogenesis, fatty acid synthesis and branched chain amino acid catabolism. Defects in this gene are the cause of holocarboxylase synthetase deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jun 2011]

Uniprot Description

HLCS: Post-translational modification of specific protein by attachment of biotin. Acts on various carboxylases such as acetyl- CoA-carboxylase, pyruvate carboxylase, propionyl CoA carboxylase, and 3-methylcrotonyl CoA carboxylase. Defects in HLCS are the cause of holocarboxylase synthetase deficiency (HLCS deficiency); also known as biotin-responsive multiple carboxylase deficiency. HLCS deficiency is a neonatal form of multiple carboxylase deficiency, an autosomal recessive disorder characterized by metabolic ketoacidosis, hyperammonemia, excretion of abnormal organic acid metabolites and dermatitis. Clinical and biochemical symptoms improve dramatically with administration of biotin. Belongs to the biotin--protein ligase family.

Protein type: Ligase; EC 6.3.4.11; EC 6.3.4.15; Mitochondrial; EC 6.3.4.10; Cofactor and Vitamin Metabolism - biotin; EC 6.3.4.9

Chromosomal Location of Human Ortholog: 21q22.13

Cellular Component: chromatin; cytoplasm; cytosol; nuclear lamina; nuclear matrix

Molecular Function: biotin binding; biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity; biotin-protein ligase activity; enzyme binding; protein binding

Biological Process: biotin metabolic process; cell proliferation; histone modification; protein amino acid biotinylation

Disease: Holocarboxylase Synthetase Deficiency

Research Articles on HLCS

Similar Products

Product Notes

The HLCS hlcs (Catalog #AAA1268761) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagata gactccacat ggataatgga ctggtacccc aaaagattgt gtcggtgcac ttgcaggact ccactctgaa ggaagttaag gatcaggtct caaacaagca agcccagatc ctagagccga agcctgaacc ttctcttgag attaagcctg agcaggacgg tatggagcat gttggcagag atgacccaaa ggctcttggt gaagaaccca aacaaaggag aggcagtgcc tctgggagtg agcctgctgg ggacagtgac aggggagggg gccccgttga gcattatcac ctccatctgt ctagttgcca cgagtgtctg gaacttgaga acagcaccat tgagtcagtc aagtttgcgt ctgccgagaa cattccagac cttccctacg attatagcag cagtttggag agtgttgctg atgagacctc ccccgaaaga gaagggagga gagtcaacct cacgggaaag gcacccaaca tcctcctcta tgtgggctcc gactcccagg aagccctcgg ccggttccac gaggtccggt ctgtgctggc cgactgtgtg gacattgaca gttatattct ctaccacctg ctggaggaca gtgctctcag agacccgtgg acggacaact gtctgctgtt ggtcattgct accagggagt ccattcccga agacctgtac cagaagttca tggcctatct ttctcaggga gggaaggtgt tgggcctgtc ttcatccttc acctttggtg gctttcaggt gacaagcaag ggtgcactgc acaagacagt ccagaacttg gttttctcca aggctgacca gagtgaggtg aagctcagcg tcttgagcag tggctgcagg taccaggaag gccccgtccg gctcagcccc ggcaggctcc agggccacct ggagaatgag gacaaggaca ggatgattgt gcatgtgcct tttggaactc gcgggggaga agctgttctt tgccaggtgc acttagaact acctcccagc tccaacatag tgcaaactcc agaagatttt aacttgctca agtcaagcaa ttttagaaga tacgaagtcc ttagagagat tctgacaacc cttggcctca gctgtgacat gaaacaagtt cctgccttaa ctcctcttta cttgctgtca gctgcggagg aaatcaggga tcctcttatg cagtggcttg ggaaacatgt ggactccgag ggagaaataa aatccggcca gctctctctt agatttgttt catcctacgt gtctgaagta gaaataaccc catcttgtat acctgtggtg accaacatgg aggccttctc atcagaacat ttcaacttag agatctatcg ccaaaatctg cagaccaagc agttggggaa agtaattttg tttgccgaag tgacccccac aacgatgcgt ctcctggatg ggctgatgtt tcagacaccg caggaaatgg gcttaatagt gatcgcggcc cggcagaccg agggcaaagg acggggaggg aatgtgtggc tgagccctgt gggatgtgct ctttctactc tgctcatctc cattccactg agatcccagc tgggacagag gatcccgttt gtccagcatc tgatgtccgt ggctgtcgtg gaagcagtga ggtccattcc cgagtatcag gatatcaact tacgagtgaa gtggcccaac gatatttatt acagtgacct catgaagatc ggcggagttc tggttaactc aacactcatg ggagaaacat tttatatact tattggctgt ggatttaatg tgactaacag taaccctacc atctgcatca acgacctcat cacagaatac aataaacaac acaaggcaga actgaagccc ttaagagccg attatctcat cgccagagtc gtgactgtgc tggagaaact gatcaaagag tttcaggaca aagggcccaa cagcgtcctt cccctttatt accgatactg ggtccacagt ggtcagcaag tccatctggg cagcgcagag ggaccaaagg tgtccatcgt tggcctggac gattctggct tcctccaggt tcaccaggag ggcggcgagg ttgtgactgt gcacccggac ggcaactcct tcgacatgct gagaaacctc atcctcccca aacggcggta a. It is sometimes possible for the material contained within the vial of "HLCS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.