Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMCO1 cdna clone

TMCO1 cDNA Clone

Gene Names
TMCO1; PCIA3; TMCC4; HP10122; PNAS-136
Synonyms
TMCO1; TMCO1 cDNA Clone; TMCO1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcactatgttcgcggacactctcctcatcgtttttatctctgtgtgcacggctctgctcgcagagggcataacctgggtcctggtttacaggacagacaagtacaagagactgaaggcagaagtggaaaaacagagtaaaaaattggaaaagaagaaggaaacaataacagagtcagctggtcgacaacagaaaaagaaaatagagagacaagaagagaaactgaagaataacaacagagatctatcaatggttcgaatgaaatccatgtttgctattggcttttgttttactgccctaatgggaatgttcaattccatatttgatggtagagtggtggcaaagcttccttttacccctctttcttacatccaaggactgtctcatcgaaatctgctgggagatgacaccacagactgttccttcattttcctgtatattctctgtactatgtcgattcgacagaacattcagaagattctcggccttgccccttcacgagccgccaccaagcaggcaggtggatttcttggcccaccacctccttctgggaagttctcttga
Sequence Length
567
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,766 Da
NCBI Official Full Name
Homo sapiens transmembrane and coiled-coil domains 1, mRNA
NCBI Official Synonym Full Names
transmembrane and coiled-coil domains 1
NCBI Official Symbol
TMCO1
NCBI Official Synonym Symbols
PCIA3; TMCC4; HP10122; PNAS-136
NCBI Protein Information
transmembrane and coiled-coil domain-containing protein 1
UniProt Protein Name
Transmembrane and coiled-coil domain-containing protein 1
UniProt Gene Name
TMCO1
UniProt Synonym Gene Names
TMCC4
UniProt Entry Name
TMCO1_HUMAN

NCBI Description

This locus encodes a transmembrane protein. Mutations at this locus have been associated with craniofacial dysmorphism, skeletal anomalies, and mental retardation. Mutations at this locus have also been associated with open angle glaucoma blindness. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]

Uniprot Description

TMCO1: Defects in TMCO1 are the cause of craniofacial dysmorphism skeletal anomalies and mental retardation syndrome (CFSMR). A disorder characterized by craniofacial and skeletal anomalies, associated with mental retardation. Typical craniofacial dysmorphism include brachycephaly, highly arched bushy eyebrows, synophrys, long eyelashes, low-set ears, microdontism of primary teeth, and generalized gingival hyperplasia, whereas Sprengel deformity of scapula, fusion of spine, rib abnormities, pectus excavatum, and pes planus represent skeletal anomalies. Belongs to the TMCO1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 1q22-q25

Cellular Component: endoplasmic reticulum; integral to endoplasmic reticulum membrane

Molecular Function: calcium channel activity

Biological Process: endoplasmic reticulum calcium ion homeostasis; ER overload response

Disease: Craniofacial Dysmorphism, Skeletal Anomalies, And Mental Retardation Syndrome

Research Articles on TMCO1

Similar Products

Product Notes

The TMCO1 tmco1 (Catalog #AAA1268732) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcacta tgttcgcgga cactctcctc atcgttttta tctctgtgtg cacggctctg ctcgcagagg gcataacctg ggtcctggtt tacaggacag acaagtacaa gagactgaag gcagaagtgg aaaaacagag taaaaaattg gaaaagaaga aggaaacaat aacagagtca gctggtcgac aacagaaaaa gaaaatagag agacaagaag agaaactgaa gaataacaac agagatctat caatggttcg aatgaaatcc atgtttgcta ttggcttttg ttttactgcc ctaatgggaa tgttcaattc catatttgat ggtagagtgg tggcaaagct tccttttacc cctctttctt acatccaagg actgtctcat cgaaatctgc tgggagatga caccacagac tgttccttca ttttcctgta tattctctgt actatgtcga ttcgacagaa cattcagaag attctcggcc ttgccccttc acgagccgcc accaagcagg caggtggatt tcttggccca ccacctcctt ctgggaagtt ctcttga. It is sometimes possible for the material contained within the vial of "TMCO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.