SGTA cdna clone
SGTA cDNA Clone
Gene Names
SGTA; SGT; hSGT; alphaSGT
Synonyms
SGTA; SGTA cDNA Clone; SGTA cdna clone
Sequence
atggacaacaagaagcgcctggcctacgccatcatccagttcctgcatgaccagctccggcacgggggcctctcgtccgatgctcaggagagcttggaagtcgccatccagtgcctggagactgcgtttggggtgacggtagaagacagtgaccttgcgctccctcagactctgccggagatatttgaagcggctgccacgggcaaggagatgccgcaggacctgaggagccccgcgcgaaccccgccttccgaggaggactcagcagaggcagagcgcctcaaaaccgaaggaaacgagcagatgaaagtggaaaactttgaagctgccgtgcatttctacggaaaagccatcgagctcaacccagccaacgccgtctatttctgcaacagagccgcagcctacagcaaactcggcaactacgcaggcgcggtgcaggactgtgagcgggccatctgcattgacccggcctacagcaaggcctacggcaggatgggcctggcgctctccagcctcaacaagcacgtggaggccgtggcttactacaagaaggctctggagctggaccccgacaacgagacatacaagtccaacctcaagatagcggagctgaagctgcgggaggcccccagccccacgggaggcgtgggcagcttcgacatcgccggcctgctgaacaaccctggcttcatgagcatggcttcgaacctaatgaacaatccccagattcagcagctcatgtccggcatgatttcgggtggcaacaaccccttgggaactcccggcaccagcccctcgcagaacgacctggccagcctcatccaggcgggccagcagtttgcccagcagatgcagcagcagaacccagagttgatagagcagctcaggagccagatccggagtcggacgcccagcgccagcaacgacgaccagcaggagtga
Sequence Length
942
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,063 Da
NCBI Official Full Name
Homo sapiens small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha, mRNA
NCBI Official Synonym Full Names
small glutamine rich tetratricopeptide repeat containing alpha
NCBI Official Symbol
SGTA
NCBI Official Synonym Symbols
SGT; hSGT; alphaSGT
NCBI Protein Information
small glutamine-rich tetratricopeptide repeat-containing protein alpha
UniProt Protein Name
Small glutamine-rich tetratricopeptide repeat-containing protein alpha
UniProt Gene Name
SGTA
UniProt Synonym Gene Names
SGT; SGT1; UBP
UniProt Entry Name
SGTA_HUMAN
NCBI Description
This gene encodes a protein which is capable of interacting with the major nonstructural protein of parvovirus H-1 and 70-kDa heat shock cognate protein; however, its function is not known. Since this transcript is expressed ubiquitously in various tissues, this protein may serve a housekeeping function. [provided by RefSeq, Jul 2008]
Uniprot Description
SGTA: Co-chaperone that binds directly to HSC70 and HSP70 and regulates their ATPase activity. Homooligomerize. Interacts with NS1 from parvovirus H-1, with Vpu and Gag from HIV-1. Interacts with SARS- CoV accessory protein 7a. Interacts with DNAJC5 and DNAJC5B. Ubiquitous. Belongs to the SGT family.
Protein type: Chaperone
Chromosomal Location of Human Ortholog: 19p13
Cellular Component: cytoplasm; cytosol; membrane
Molecular Function: protein binding
Research Articles on SGTA
Similar Products
Product Notes
The SGTA sgta (Catalog #AAA1268720) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaaca agaagcgcct ggcctacgcc atcatccagt tcctgcatga ccagctccgg cacgggggcc tctcgtccga tgctcaggag agcttggaag tcgccatcca gtgcctggag actgcgtttg gggtgacggt agaagacagt gaccttgcgc tccctcagac tctgccggag atatttgaag cggctgccac gggcaaggag atgccgcagg acctgaggag ccccgcgcga accccgcctt ccgaggagga ctcagcagag gcagagcgcc tcaaaaccga aggaaacgag cagatgaaag tggaaaactt tgaagctgcc gtgcatttct acggaaaagc catcgagctc aacccagcca acgccgtcta tttctgcaac agagccgcag cctacagcaa actcggcaac tacgcaggcg cggtgcagga ctgtgagcgg gccatctgca ttgacccggc ctacagcaag gcctacggca ggatgggcct ggcgctctcc agcctcaaca agcacgtgga ggccgtggct tactacaaga aggctctgga gctggacccc gacaacgaga catacaagtc caacctcaag atagcggagc tgaagctgcg ggaggccccc agccccacgg gaggcgtggg cagcttcgac atcgccggcc tgctgaacaa ccctggcttc atgagcatgg cttcgaacct aatgaacaat ccccagattc agcagctcat gtccggcatg atttcgggtg gcaacaaccc cttgggaact cccggcacca gcccctcgca gaacgacctg gccagcctca tccaggcggg ccagcagttt gcccagcaga tgcagcagca gaacccagag ttgatagagc agctcaggag ccagatccgg agtcggacgc ccagcgccag caacgacgac cagcaggagt ga. It is sometimes possible for the material contained within the vial of "SGTA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
