Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DIP2A cdna clone

DIP2A cDNA Clone

Gene Names
DIP2A; DIP2; C21orf106
Synonyms
DIP2A; DIP2A cDNA Clone; DIP2A cdna clone
Ordering
For Research Use Only!
Sequence
atgcggtaccaccccatcgacattgagacctctgtcatccgagcacacaggagcatcgctgagtgtgccgtattcacctggaccaacctgctggtggtggtggtggagctggatgggctagagcaggatgccctggacctggtggccctggtgaccaacgtggtgctggaggagcactacctggtcgtgggagtggtggtcatcgtggacccaggggtgatccctatcaactctcggggtgagaagcagcgcatgcacctgcgggacggcttcctggctgaccagctggaccccatctatgtcgcctacaacatgtga
Sequence Length
318
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
169,917 Da
NCBI Official Full Name
Homo sapiens DIP2 disco-interacting protein 2 homolog A (Drosophila), mRNA
NCBI Official Synonym Full Names
disco interacting protein 2 homolog A
NCBI Official Symbol
DIP2A
NCBI Official Synonym Symbols
DIP2; C21orf106
NCBI Protein Information
disco-interacting protein 2 homolog A
UniProt Protein Name
Disco-interacting protein 2 homolog A
Protein Family
UniProt Gene Name
DIP2A
UniProt Synonym Gene Names
C21orf106; DIP2; KIAA0184; DIP2 homolog A
UniProt Entry Name
DIP2A_HUMAN

NCBI Description

The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

Uniprot Description

DIP2A: May provide positional cues for axon pathfinding and patterning in the central nervous system. Belongs to the DIP2 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Receptor, misc.

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: cell surface

Molecular Function: protein binding

Biological Process: regulation of apoptosis

Research Articles on DIP2A

Similar Products

Product Notes

The DIP2A dip2a (Catalog #AAA1268707) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggtacc accccatcga cattgagacc tctgtcatcc gagcacacag gagcatcgct gagtgtgccg tattcacctg gaccaacctg ctggtggtgg tggtggagct ggatgggcta gagcaggatg ccctggacct ggtggccctg gtgaccaacg tggtgctgga ggagcactac ctggtcgtgg gagtggtggt catcgtggac ccaggggtga tccctatcaa ctctcggggt gagaagcagc gcatgcacct gcgggacggc ttcctggctg accagctgga ccccatctat gtcgcctaca acatgtga. It is sometimes possible for the material contained within the vial of "DIP2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.