Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPINLW1 cdna clone

SPINLW1 cDNA Clone

Gene Names
EPPIN; CT71; CT72; WAP7; WFDC7; SPINLW1; dJ461P17.2
Synonyms
SPINLW1; SPINLW1 cDNA Clone; SPINLW1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggatcttctggacttttgagcctcctggtgctattcgtcctcttagcgaatgtccagggacctggtctgactgattggttatttcccaggagatgtcccaaaatcagagaagaatgtgaattccaagaaagggatgtgtgtacaaaggacagacaatgccaggacaacaagaagtgttgtgtcttcagctgcggaaaaaaatgtttagatctcaaacaagatgtatgcgaaatgccaaaagaaactggcccctgcctggcttattttcttcattggtggtatgacaagaaagataatacttgctccatgtttgtctatggtggctgccagggaaacaataacaacttccaatccaaagccaactgcctgaacacctgcaagaataaacgctttccctga
Sequence Length
402
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,486 Da
NCBI Official Full Name
Homo sapiens serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin), mRNA
NCBI Official Synonym Full Names
epididymal peptidase inhibitor
NCBI Official Symbol
EPPIN
NCBI Official Synonym Symbols
CT71; CT72; WAP7; WFDC7; SPINLW1; dJ461P17.2
NCBI Protein Information
eppin
UniProt Protein Name
Eppin
UniProt Gene Name
EPPIN
UniProt Synonym Gene Names
SPINLW1; WAP7; WFDC7; CT71
UniProt Entry Name
EPPI_HUMAN

NCBI Description

This gene encodes an epididymal protease inhibitor, which contains both kunitz-type and WAP-type four-disulfide core (WFDC) protease inhibitor consensus sequences. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene is a member of the WFDC gene family and belongs to the telomeric cluster. The protein can inhibit human sperm motility and exhibits antimicrobial activity against E. coli, and polymorphisms in this gene are associated with male infertility. Read-through transcription also exists between this gene and the downstream WFDC6 (WAP four-disulfide core domain 6) gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]

Uniprot Description

Spinlw1: Serine protease inhibitor that plays an essential role in male reproduction and fertility. Modulates the hydrolysis of SEMG1 by KLK3/PSA (a serine protease), provides antimicrobial protection for spermatozoa in the ejaculate coagulum, and binds SEMG1 thereby inhibiting sperm motility. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Cancer Testis Antigen (CTA); Inhibitor; Secreted

Chromosomal Location of Human Ortholog: 20q13.12

Cellular Component: cell surface; extracellular space; protein complex

Molecular Function: protein binding

Biological Process: defense response to bacterium; negative regulation of peptidase activity; protein oligomerization

Research Articles on SPINLW1

Similar Products

Product Notes

The SPINLW1 eppin (Catalog #AAA1268681) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggatctt ctggactttt gagcctcctg gtgctattcg tcctcttagc gaatgtccag ggacctggtc tgactgattg gttatttccc aggagatgtc ccaaaatcag agaagaatgt gaattccaag aaagggatgt gtgtacaaag gacagacaat gccaggacaa caagaagtgt tgtgtcttca gctgcggaaa aaaatgttta gatctcaaac aagatgtatg cgaaatgcca aaagaaactg gcccctgcct ggcttatttt cttcattggt ggtatgacaa gaaagataat acttgctcca tgtttgtcta tggtggctgc cagggaaaca ataacaactt ccaatccaaa gccaactgcc tgaacacctg caagaataaa cgctttccct ga. It is sometimes possible for the material contained within the vial of "SPINLW1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.