ITIH5 cdna clone
ITIH5 cDNA Clone
Gene Names
ITIH5; ITI-HC5; PP14776
Synonyms
ITIH5; ITIH5 cDNA Clone; ITIH5 cdna clone
Sequence
atgcggaactatgattctgggcctcccccatctactgtcattaaccaaaatgaaacatttgccaacataatttttaaacctactgtagtacaacaagccaggattgcccagaatggaattttgggagactttattattagatatgacgtcaatagagaacagagcattggggacatccaggttctaaatggctattttgtgcactactttgctcctaaagaccttcctcctttacccaagaatgtggtattcgtgcttgacagcagtgcttctatggtgggaaccaaactccggcagaccaaggatgccctcttcacaattctccatgacctccgaccccaggaccgtttcagtatcattggattttccaaccggatcaaagtatggaaggaccacttgatatcagtcactccagacagcatcagggatgggaaagtgtacattcaccatatgtcacccactggaggcacagacatcaacggggccctgcagagggccatcaggctcctcaacaagtacgtggcccacagtggcattggagaccggagcgtgtccctcatcgtcttcctgacggatgggaagcccacggtcggggagacgcacaccctcaagatcctcaacaacacccgagaggccgcccgaggccaagtctgcatcttcaccattggcatcggcaacgacgtggacttcaggctgctggagaaactgtcgctggagaactgtggcctcacacggcgcgtgcacgaggaggaggacgcaggctcgcagctcatcgggttctacgatgaaatcaggactccgctcctctctgacatccgcatcgattatccccccagctcagtggtgcaggccaccaagaccctgttccccaactacttcaacggctcggagatcatcattgcggggaagctggtggacaggaagctggatcacctgcacgtggaggtcaccgccagcaacagtaagaaattcatcatcctgaagacagatgtgcctgtgcggcctcagaaggcagggaaagatgtcacaggaagccccaggcctggaggcgatggagagggggacaccaaccacatcgagcgtctctggagctacctcaccacaaaggagctgctgagctcctggctgcaaagtgacgatgaaccggagaaggagcggctgcggcagcgggcccaggccctggctgtgagctaccgcttcctcactcccttcacctccatgaagctgagggggccggtcccacgcatggatggcctggaggaggcccacggcatgtcggctgccatgggacccgaaccggtggtgcagagcgtgcgaggagctggcacgcagccaggacctttgctcaagaagccataccagccaagaattaaaatctctaaaacatcagtggatggtgatccccactttgttgtggatttccccctgagcagactcaccgtgtgcttcaacattgatgggcagcccggggacatcctcaggctggtctctgatcacagggactctggtgtcacagtgaacggagagttaattggggcacccgcccctccaaatggccacaagaaacagcgcacttacttgcgcactatcaccatcctcatcaacaagccagagagatcttatctcgagatcacaccgagcagagtcatcttggatggtggggacagactggtgctcccctgcaaccagagtgtggtggtggggagctgggggctggaggtgtccgtgtctgccaacgccaatgtcaccgtcaccatccagggctccatagcctttgtcatcctcatccacctctacaaaaagccggcgcccttccagcgacaccacctgggtttctacattgccaacagcgagggcctttccagcaactgccacggactgctgggtcagttcctgaatcaggatgccagactcacagaagaccctgcagggcccagccagaacctcactcaccctctgctccttcaggtgggagaggggcctgaggccgtcctaacagtgaaaggccaccaagtcccagtggtctggaagcaaaggaagatttacaacggggaagagcagatagactgctggtttgccaggaacaatgccgccaaactgattgacggggagtacaaggattacctggcatcccatccatttgacacagggatgacacttggccagggaatgtccagggagctctga
Sequence Length
2187
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,191 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:3616602, containing frame-shift errors
NCBI Official Synonym Full Names
inter-alpha-trypsin inhibitor heavy chain family member 5
NCBI Official Symbol
ITIH5
NCBI Official Synonym Symbols
ITI-HC5; PP14776
NCBI Protein Information
inter-alpha-trypsin inhibitor heavy chain H5
UniProt Protein Name
Inter-alpha-trypsin inhibitor heavy chain H5
Protein Family
UniProt Gene Name
ITIH5
UniProt Synonym Gene Names
KIAA1953; ITI heavy chain H5; ITI-HC5; Inter-alpha-inhibitor heavy chain 5
UniProt Entry Name
ITIH5_HUMAN
NCBI Description
This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Uniprot Description
ITIH5: May act as a tumor suppressor. Belongs to the ITIH family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: 10p14
Research Articles on ITIH5
Similar Products
Product Notes
The ITIH5 itih5 (Catalog #AAA1268632) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggaact atgattctgg gcctccccca tctactgtca ttaaccaaaa tgaaacattt gccaacataa tttttaaacc tactgtagta caacaagcca ggattgccca gaatggaatt ttgggagact ttattattag atatgacgtc aatagagaac agagcattgg ggacatccag gttctaaatg gctattttgt gcactacttt gctcctaaag accttcctcc tttacccaag aatgtggtat tcgtgcttga cagcagtgct tctatggtgg gaaccaaact ccggcagacc aaggatgccc tcttcacaat tctccatgac ctccgacccc aggaccgttt cagtatcatt ggattttcca accggatcaa agtatggaag gaccacttga tatcagtcac tccagacagc atcagggatg ggaaagtgta cattcaccat atgtcaccca ctggaggcac agacatcaac ggggccctgc agagggccat caggctcctc aacaagtacg tggcccacag tggcattgga gaccggagcg tgtccctcat cgtcttcctg acggatggga agcccacggt cggggagacg cacaccctca agatcctcaa caacacccga gaggccgccc gaggccaagt ctgcatcttc accattggca tcggcaacga cgtggacttc aggctgctgg agaaactgtc gctggagaac tgtggcctca cacggcgcgt gcacgaggag gaggacgcag gctcgcagct catcgggttc tacgatgaaa tcaggactcc gctcctctct gacatccgca tcgattatcc ccccagctca gtggtgcagg ccaccaagac cctgttcccc aactacttca acggctcgga gatcatcatt gcggggaagc tggtggacag gaagctggat cacctgcacg tggaggtcac cgccagcaac agtaagaaat tcatcatcct gaagacagat gtgcctgtgc ggcctcagaa ggcagggaaa gatgtcacag gaagccccag gcctggaggc gatggagagg gggacaccaa ccacatcgag cgtctctgga gctacctcac cacaaaggag ctgctgagct cctggctgca aagtgacgat gaaccggaga aggagcggct gcggcagcgg gcccaggccc tggctgtgag ctaccgcttc ctcactccct tcacctccat gaagctgagg gggccggtcc cacgcatgga tggcctggag gaggcccacg gcatgtcggc tgccatggga cccgaaccgg tggtgcagag cgtgcgagga gctggcacgc agccaggacc tttgctcaag aagccatacc agccaagaat taaaatctct aaaacatcag tggatggtga tccccacttt gttgtggatt tccccctgag cagactcacc gtgtgcttca acattgatgg gcagcccggg gacatcctca ggctggtctc tgatcacagg gactctggtg tcacagtgaa cggagagtta attggggcac ccgcccctcc aaatggccac aagaaacagc gcacttactt gcgcactatc accatcctca tcaacaagcc agagagatct tatctcgaga tcacaccgag cagagtcatc ttggatggtg gggacagact ggtgctcccc tgcaaccaga gtgtggtggt ggggagctgg gggctggagg tgtccgtgtc tgccaacgcc aatgtcaccg tcaccatcca gggctccata gcctttgtca tcctcatcca cctctacaaa aagccggcgc ccttccagcg acaccacctg ggtttctaca ttgccaacag cgagggcctt tccagcaact gccacggact gctgggtcag ttcctgaatc aggatgccag actcacagaa gaccctgcag ggcccagcca gaacctcact caccctctgc tccttcaggt gggagagggg cctgaggccg tcctaacagt gaaaggccac caagtcccag tggtctggaa gcaaaggaag atttacaacg gggaagagca gatagactgc tggtttgcca ggaacaatgc cgccaaactg attgacgggg agtacaagga ttacctggca tcccatccat ttgacacagg gatgacactt ggccagggaa tgtccaggga gctctga. It is sometimes possible for the material contained within the vial of "ITIH5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
