Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UNKL cdna clone

UNKL cDNA Clone

Gene Names
UNKL; ZC3H5L; C16orf28; ZC3HDC5L
Synonyms
UNKL; UNKL cDNA Clone; UNKL cdna clone
Ordering
For Research Use Only!
Sequence
atgccgtcggtctcgaaagcggcggcagcggcgctgagcgggtcccccccgcagacggagaagccgacccactacaggtacctgaaggagttcaggacggagcagtgccccctgttttcacagcacaagtgcgcgcagcaccggccgttcacctgcttccactggcacttcctcaaccagcggcgccgcaggcccctccgcaggcgcgacggcaccttcaactacagccccgacgtgtactgctccaagtacaacgaagccaccggcgtgtgccccgacggcgacgagtgtccctacctgcaccggacgacgggggacacagaacgcaagtaccacctgcgttactacaaaacaggaacctgcatccacgagacagacgcacgtggccactgcgtgaagaatgggctgcactgtgccttcgcgcacggccccctggacctgcggccgcccgtgtgtgacgtcagggagctgcaggcccaggaagccttgcagaacggccagctgggcggcggggaaggggtcccggatctgcagcctggggtcttggccagccaggccatgattgagaagatcctgagcgaggacccccggtggcaagatgccaacttcgtgctgggcagctacaagacggagcagtgcccgaagccgccacgcctgtgccgccagggctatgcgtgcccacactaccacaatagccgggacaggcggcgcaacccccggcggttccagtacagctggcagctgggacgccgggtccttaggctgagtcccagggccaacaacccaagggtcgccctgcccagggtgcacacaggaccttcctccaccgcctga
Sequence Length
834
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
81,571 Da
NCBI Official Full Name
Homo sapiens unkempt homolog (Drosophila)-like, mRNA
NCBI Official Synonym Full Names
unkempt family like zinc finger
NCBI Official Symbol
UNKL
NCBI Official Synonym Symbols
ZC3H5L; C16orf28; ZC3HDC5L
NCBI Protein Information
putative E3 ubiquitin-protein ligase UNKL
UniProt Protein Name
Putative E3 ubiquitin-protein ligase UNKL
UniProt Gene Name
UNKL
UniProt Synonym Gene Names
C16orf28; ZC3H5L; ZC3HDC5L
UniProt Entry Name
UNKL_HUMAN

NCBI Description

This gene encodes a RING finger protein that may function in Rac signaling. It can bind to Brg/Brm-associated factor 60b and can promote its ubiquitination. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]

Uniprot Description

UNKL: May participate in a protein complex showing an E3 ligase activity regulated by RAC1. Ubiquitination is directed towards itself and possibly other substrates, such as SMARCD2/BAF60b. Intrinsic E3 ligase activity has not been proven. Belongs to the unkempt family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.-; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: cytosol

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: protein polyubiquitination

Research Articles on UNKL

Similar Products

Product Notes

The UNKL unkl (Catalog #AAA1268630) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgtcgg tctcgaaagc ggcggcagcg gcgctgagcg ggtccccccc gcagacggag aagccgaccc actacaggta cctgaaggag ttcaggacgg agcagtgccc cctgttttca cagcacaagt gcgcgcagca ccggccgttc acctgcttcc actggcactt cctcaaccag cggcgccgca ggcccctccg caggcgcgac ggcaccttca actacagccc cgacgtgtac tgctccaagt acaacgaagc caccggcgtg tgccccgacg gcgacgagtg tccctacctg caccggacga cgggggacac agaacgcaag taccacctgc gttactacaa aacaggaacc tgcatccacg agacagacgc acgtggccac tgcgtgaaga atgggctgca ctgtgccttc gcgcacggcc ccctggacct gcggccgccc gtgtgtgacg tcagggagct gcaggcccag gaagccttgc agaacggcca gctgggcggc ggggaagggg tcccggatct gcagcctggg gtcttggcca gccaggccat gattgagaag atcctgagcg aggacccccg gtggcaagat gccaacttcg tgctgggcag ctacaagacg gagcagtgcc cgaagccgcc acgcctgtgc cgccagggct atgcgtgccc acactaccac aatagccggg acaggcggcg caacccccgg cggttccagt acagctggca gctgggacgc cgggtcctta ggctgagtcc cagggccaac aacccaaggg tcgccctgcc cagggtgcac acaggacctt cctccaccgc ctga. It is sometimes possible for the material contained within the vial of "UNKL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.