Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP49 cdna clone

USP49 cDNA Clone

Synonyms
USP49; USP49 cDNA Clone; USP49 cdna clone
Ordering
For Research Use Only!
Sequence
atggatagatgcaaacatgtagggcggttacggctcgcccaggaccactccatcctgaaccctcagaagtggtgctgcttagagtgtgccaccaccgagtccgtgtgggcctgcctcaagtgctcccacgtggcctgcggccgctatattgaggaccacgccctgaaacactttgaggagacgggacacccgctagccatggaagtccgggatctctacgtgttctgttacctgtgcaaggactacgtgctcaatgataacccagagggggacctgaagctgctaagaagctccctcctggcggtccggggccagaaacaggacacgccggtgagacgtgggcggacgctgcggtccatggcttcgggtgaggacgtggtcctgccgcagcgcgctcctcagggacagccgcagatgctcacggctctgtggtaccggcgtcagcgcctgctggccaggacgctgcggctgtggttcgagaagagctcccggggccaggcgaagctggagcagcggcggcaggaggaggccctggagcgcaagaaggaggaggcgcggaggcggcggcgcgaggtgaaacggcggctgctggaggagctggccagcacccctccgcgcaagagtgcacggctgctcctgcacacgccccgcgacgcgggcccggctgcctcgcgccccgccgccctccctacctcacgcagagtgcccgccgccacactcaagctgcgtcgccagccggccatggccccaggcgtcacgggcctgcgcaacctgggcaacacctgctacatgaactccatcctccaggtgctcagccacctccagaagttccgagaatgtttcctcaaccttgacccttccaaaacggaacatctgtttcccaaagccaccaacgggaagactcagctttctggcaagccaaccaacagctcggccacggagctgtccttgagaaatgacagggccgaggcatgcgagcgggagggcttctgctggaacggcagggcctccattagtcggagtctggagctcatccagaacaaggagccgagttcaaagcacatttccctctgccgtgaactgcacaccctcttccgagtcatgtggtccgggaagtgggccctagtgtcgcccttcgccatgctgcactcagtgtggagcctgatccctgccttccgcggctacgaccaacaggacgcgcaggaatttctctgcgagctgctgcacaaggtgcagcaggaactcgagtctgagggcaccacacgccggatcctcatccccttctcccagaggaagctcaccaaacaggtcttaaaggtggtgaataccatatttcatgggcagctgctcagtcaggtcacatgtatatcatgcaattacaaatccaataccattgagcccttttgggacctatccctggaattccctgaacgctatcactgcatagaaaaggggtttgtccctttgaatcaaacagagtgcttgctcactgagatgctggccaaattcacagagacagaggccctggaagggagaatctacgcttgtgaccagtgtaacagcaaacgacgaaaatccaatcccaaaccccttgttctgagtgaagctagaaagcagttaatgatctacagactacctcaggttctccggctgcaccttaaaagattcaggtggtctggccgtaatcatcgagagaagattggggtccatgtcgtctttgaccaggtattaaccatggaaccttactgctgcagggacatgctctcctctcttgacaaagagacctttgcctatgatctctccgcagtggtcatgcatcacgggaaagggtttggctcaggacactacacagcctattgctacaacacagagggaggtgcgtgcgctttactctgtggggtgggggacacggaaaggggttga
Sequence Length
1923
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,455 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 49, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 49
NCBI Official Symbol
USP49
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 49
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 49
UniProt Gene Name
USP49
UniProt Entry Name
UBP49_HUMAN

Uniprot Description

USP49: Belongs to the peptidase C19 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.19.12; Ubiquitin-specific protease; Protease

Chromosomal Location of Human Ortholog: 6p21

Molecular Function: cysteine-type endopeptidase activity; histone binding; protein binding; ubiquitin-specific protease activity

Biological Process: nuclear mRNA splicing, via spliceosome; protein deubiquitination

Research Articles on USP49

Similar Products

Product Notes

The USP49 usp49 (Catalog #AAA1268606) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatagat gcaaacatgt agggcggtta cggctcgccc aggaccactc catcctgaac cctcagaagt ggtgctgctt agagtgtgcc accaccgagt ccgtgtgggc ctgcctcaag tgctcccacg tggcctgcgg ccgctatatt gaggaccacg ccctgaaaca ctttgaggag acgggacacc cgctagccat ggaagtccgg gatctctacg tgttctgtta cctgtgcaag gactacgtgc tcaatgataa cccagagggg gacctgaagc tgctaagaag ctccctcctg gcggtccggg gccagaaaca ggacacgccg gtgagacgtg ggcggacgct gcggtccatg gcttcgggtg aggacgtggt cctgccgcag cgcgctcctc agggacagcc gcagatgctc acggctctgt ggtaccggcg tcagcgcctg ctggccagga cgctgcggct gtggttcgag aagagctccc ggggccaggc gaagctggag cagcggcggc aggaggaggc cctggagcgc aagaaggagg aggcgcggag gcggcggcgc gaggtgaaac ggcggctgct ggaggagctg gccagcaccc ctccgcgcaa gagtgcacgg ctgctcctgc acacgccccg cgacgcgggc ccggctgcct cgcgccccgc cgccctccct acctcacgca gagtgcccgc cgccacactc aagctgcgtc gccagccggc catggcccca ggcgtcacgg gcctgcgcaa cctgggcaac acctgctaca tgaactccat cctccaggtg ctcagccacc tccagaagtt ccgagaatgt ttcctcaacc ttgacccttc caaaacggaa catctgtttc ccaaagccac caacgggaag actcagcttt ctggcaagcc aaccaacagc tcggccacgg agctgtcctt gagaaatgac agggccgagg catgcgagcg ggagggcttc tgctggaacg gcagggcctc cattagtcgg agtctggagc tcatccagaa caaggagccg agttcaaagc acatttccct ctgccgtgaa ctgcacaccc tcttccgagt catgtggtcc gggaagtggg ccctagtgtc gcccttcgcc atgctgcact cagtgtggag cctgatccct gccttccgcg gctacgacca acaggacgcg caggaatttc tctgcgagct gctgcacaag gtgcagcagg aactcgagtc tgagggcacc acacgccgga tcctcatccc cttctcccag aggaagctca ccaaacaggt cttaaaggtg gtgaatacca tatttcatgg gcagctgctc agtcaggtca catgtatatc atgcaattac aaatccaata ccattgagcc cttttgggac ctatccctgg aattccctga acgctatcac tgcatagaaa aggggtttgt ccctttgaat caaacagagt gcttgctcac tgagatgctg gccaaattca cagagacaga ggccctggaa gggagaatct acgcttgtga ccagtgtaac agcaaacgac gaaaatccaa tcccaaaccc cttgttctga gtgaagctag aaagcagtta atgatctaca gactacctca ggttctccgg ctgcacctta aaagattcag gtggtctggc cgtaatcatc gagagaagat tggggtccat gtcgtctttg accaggtatt aaccatggaa ccttactgct gcagggacat gctctcctct cttgacaaag agacctttgc ctatgatctc tccgcagtgg tcatgcatca cgggaaaggg tttggctcag gacactacac agcctattgc tacaacacag agggaggtgc gtgcgcttta ctctgtgggg tgggggacac ggaaaggggt tga. It is sometimes possible for the material contained within the vial of "USP49, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.