NKIRAS2 cdna clone
NKIRAS2 cDNA Clone
Gene Names
NKIRAS2; KBRAS2; kappaB-Ras2
Synonyms
NKIRAS2; NKIRAS2 cDNA Clone; NKIRAS2 cdna clone
Sequence
atggggaagagctgcaaggtggtcgtgtgtggccaggcgtctgtgggcaaaacttcaatcctggagcagcttctgtatgggaaccatgtagtgggttcggagatgatcgagacgcaggaggacatctacgtgggctccattgagacagaccggggggtgcgagagcaggtgcgtttctatgacacccgggggctccgagatggggccgaactgccccgacactgcttctcttgcactgatggctacgtcctggtctatagcacagatagcagagagtcttttcagcgtgtggagctgctcaagaaggagattgacaaatccaaggacaagaaggaggtcaccatcgtggtccttggcaacaagtgtgacttacaggagcagcggcgtgtagacccagatgtggctcagcactgggccaagtcagagaaggtgaagctgtgggaggtgtcagtggcggaccggcgctccctcctggagccctttgtctacttggccagcaagatgacgcaaccccagagcaagtctgccttccccctcagccggaagaacaagggcagcggctccttggatggctga
Sequence Length
576
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
10,770 Da
NCBI Official Full Name
Homo sapiens NFKB inhibitor interacting Ras-like 2, mRNA
NCBI Official Synonym Full Names
NFKB inhibitor interacting Ras like 2
NCBI Official Symbol
NKIRAS2
NCBI Official Synonym Symbols
KBRAS2; kappaB-Ras2
NCBI Protein Information
NF-kappa-B inhibitor-interacting Ras-like protein 2
UniProt Protein Name
NF-kappa-B inhibitor-interacting Ras-like protein 2
Protein Family
UniProt Gene Name
NKIRAS2
UniProt Synonym Gene Names
KBRAS2; Kappa B-Ras protein 2; KappaB-Ras2
UniProt Entry Name
KBRS2_HUMAN
Uniprot Description
NKIRAS2: Atypical Ras-like protein that acts as a potent regulator of NF-kappa-B activity by preventing the degradation of NF-kappa-B inhibitor beta (NFKBIB) by most signals, explaining why NFKBIB is more resistant to degradation. May act by blocking phosphorylation of NFKBIB and nuclear localization of p65/RELA NF- kappa-B subunit. It is unclear whether it acts as a GTPase. Both GTP- and GDP-bound forms block phosphorylation of NFKBIB. Belongs to the small GTPase superfamily. Ras family. KappaB-Ras subfamily. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: G protein; G protein, monomeric, Ras; G protein, monomeric
Chromosomal Location of Human Ortholog: 17q21.2
Research Articles on NKIRAS2
Similar Products
Product Notes
The NKIRAS2 nkiras2 (Catalog #AAA1268580) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaaga gctgcaaggt ggtcgtgtgt ggccaggcgt ctgtgggcaa aacttcaatc ctggagcagc ttctgtatgg gaaccatgta gtgggttcgg agatgatcga gacgcaggag gacatctacg tgggctccat tgagacagac cggggggtgc gagagcaggt gcgtttctat gacacccggg ggctccgaga tggggccgaa ctgccccgac actgcttctc ttgcactgat ggctacgtcc tggtctatag cacagatagc agagagtctt ttcagcgtgt ggagctgctc aagaaggaga ttgacaaatc caaggacaag aaggaggtca ccatcgtggt ccttggcaac aagtgtgact tacaggagca gcggcgtgta gacccagatg tggctcagca ctgggccaag tcagagaagg tgaagctgtg ggaggtgtca gtggcggacc ggcgctccct cctggagccc tttgtctact tggccagcaa gatgacgcaa ccccagagca agtctgcctt ccccctcagc cggaagaaca agggcagcgg ctccttggat ggctga. It is sometimes possible for the material contained within the vial of "NKIRAS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
