Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STMN1 cdna clone

STMN1 cDNA Clone

Gene Names
STMN1; Lag; SMN; OP18; PP17; PP19; PR22; LAP18; C1orf215
Synonyms
STMN1; STMN1 cDNA Clone; STMN1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttcttctgatatccaggtgaaagaactggagaagcgtgcctcaggccaggcttttgagctgattctcagccctcggtcaaaagaatctgttccagaattccccctttcccctccaaagaagaaggatctttccctggaggaaattcagaagaaattagaagctgcagaagaaagacgcaagtcccatgaagctgaggtcttgaagcagctggctgagaaacgagagcacgagaaagaagtgcttcagaaggcaatagaagagaacaacaacttcagtaaaatggcagaagagaaactgacccacaaaatggaagctaataaagagaaccgagaggcacaaatggctgccaaactggaacgtttgcgagagaaggataagcacattgaagaagtgcggaagaacaaagaatccaaagaccctgctgacgagactgaagctgactaa
Sequence Length
450
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,824 Da
NCBI Official Full Name
Homo sapiens stathmin 1/oncoprotein 18, mRNA
NCBI Official Synonym Full Names
stathmin 1
NCBI Official Symbol
STMN1
NCBI Official Synonym Symbols
Lag; SMN; OP18; PP17; PP19; PR22; LAP18; C1orf215
NCBI Protein Information
stathmin
UniProt Protein Name
Stathmin
Protein Family
UniProt Gene Name
STMN1
UniProt Synonym Gene Names
C1orf215; LAP18; OP18; Op18; pp19
UniProt Entry Name
STMN1_HUMAN

NCBI Description

This gene belongs to the stathmin family of genes. It encodes a ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals of the cellular environment. The encoded protein is involved in the regulation of the microtubule filament system by destabilizing microtubules. It prevents assembly and promotes disassembly of microtubules. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]

Uniprot Description

STMN1: a microtubule-associated protein involved in the regulation of the microtubule filament system by destabilizing microtubules. It prevents assembly and promotes disassembly of microtubules. Phosphorylation reduces tubulin binding 10-fold and suppresses the MT polymerization inhibition activity. Present in much greater abundance in cells from patients with acute leukemia of different subtypes than in normal peripheral blood lymphocytes, nonleukemic proliferating lymphoid cells, bone marrow cells, or cells from patients with chronic lymphoid or myeloid leukemia.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 1p36.11

Cellular Component: cytoplasm; intracellular; neuron projection

Molecular Function: protein binding; signal transducer activity; tubulin binding

Biological Process: cytokinesis after mitosis; microtubule depolymerization; mitotic spindle organization and biogenesis; neurite development; regulation of cytoskeleton organization and biogenesis; response to virus

Research Articles on STMN1

Similar Products

Product Notes

The STMN1 stmn1 (Catalog #AAA1268543) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttctt ctgatatcca ggtgaaagaa ctggagaagc gtgcctcagg ccaggctttt gagctgattc tcagccctcg gtcaaaagaa tctgttccag aattccccct ttcccctcca aagaagaagg atctttccct ggaggaaatt cagaagaaat tagaagctgc agaagaaaga cgcaagtccc atgaagctga ggtcttgaag cagctggctg agaaacgaga gcacgagaaa gaagtgcttc agaaggcaat agaagagaac aacaacttca gtaaaatggc agaagagaaa ctgacccaca aaatggaagc taataaagag aaccgagagg cacaaatggc tgccaaactg gaacgtttgc gagagaagga taagcacatt gaagaagtgc ggaagaacaa agaatccaaa gaccctgctg acgagactga agctgactaa. It is sometimes possible for the material contained within the vial of "STMN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.