Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PEX13 cdna clone

PEX13 cDNA Clone

Gene Names
PEX13; ZWS; NALD; PBD11A; PBD11B
Synonyms
PEX13; PEX13 cDNA Clone; PEX13 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtcccagccgccacctccccccaaaccctgggagacccgccgaattccgggagccggaccgggaccaggaccgggccccactttccaatctgctgatttgggtcctactttaatgacaagacctggacaaccagcacttaccagagtgcccccacctattcttccaaggccatcacagcagacaggaagtagcagtgtgaacacttttagacctgcttacagttcattttcttctggatatggtgcctatggaaattcattttatggaggctatagtccttatagttatggatataatgggctgggctacaaccgcctccgtgtagatgatcttccacccagtagatttgttcagcaagctgaagaaagcagcaggggtgcatttcagtccattgaaagtattgtgcatgcatttgcctctgtcagtatgatgatggatgctaccttttcagctgtctataacagtttcagggctgtattggatgtagcaaatcacttttcccgattgaaaatacactttacaaaagtgttttcagcttttgcattggttaggactatacggtatctttacagacggctacagcggatgttaggtttaagaagaggctctgagaatgaagacctctgggcagagagtgaaggaactgtggcatgccttggtgctgaggaccgagcagctacctcagcaaaatcttggccaatattcttgttctttgctgttatccttggtggtccttacctcatttggaaactattgtctactcacagtgatgaagtaacagacagcatcaactgggcaagtggtgaggatgaccatgtagttgccagagcagaatatgattttgctgccgtatctgaagaagaaatttctttccgggctggtgatatgctgaacttagctctcaaagaacaacaacccaaagtgcgtggttggcttctggctagccttgatggccaaacaacaggacttatacctgcgaattatgtcaaaattcttggcaaaagaaaaggtaggaaaacggtggaatcaagtaaagtttccaagcagcaacaatcttttaccaacccaacactaactaaaggagccacggttgctgattctttggatgaacaggaagctgcctttgaatctgtttttgttgaaactaataaggttccagttgcacctgattccattgggaaagatggagaaaagcaagatctttga
Sequence Length
1212
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,130 Da
NCBI Official Full Name
Homo sapiens peroxisomal biogenesis factor 13, mRNA
NCBI Official Synonym Full Names
peroxisomal biogenesis factor 13
NCBI Official Symbol
PEX13
NCBI Official Synonym Symbols
ZWS; NALD; PBD11A; PBD11B
NCBI Protein Information
peroxisome biogenesis factor 13
UniProt Protein Name
Peroxisomal membrane protein PEX13
UniProt Gene Name
PEX13
UniProt Entry Name
PEX13_HUMAN

NCBI Description

This gene encodes a peroxisomal membrane protein that binds the type 1 peroxisomal targeting signal receptor via a SH3 domain located in the cytoplasm. Mutations and deficiencies in peroxisomal protein importing and peroxisome assembly lead to peroxisomal biogenesis disorders, an example of which is Zellweger syndrome. [provided by RefSeq, Oct 2008]

Uniprot Description

PEX13: Component of the peroxisomal translocation machinery with PEX14 and PEX17. Functions as a docking factor for the predominantly cytoplasmic PTS1 receptor (PAS10/PEX5). Involved in the import of PTS1 and PTS2 proteins. Defects in PEX13 are the cause of peroxisome biogenesis disorder complementation group 13 (PBD-CG13); also known as PBD-CGH. PBD-CG13 is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders (PBD group) are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome (ZWS), neonatal adrenoleukodystrophy (NALD), infantile Refsum disease (IRD), and classical rhizomelic chondrodysplasia punctata (RCDP). ZWS, NALD and IRD are distinct from RCDP and constitute a clinical continuum of overlapping phenotypes known as the Zellweger spectrum (PBD-ZSS). Defects in PEX13 are a cause of adrenoleukodystrophy neonatal (NALD). NALD is a peroxisome biogenesis disorder (PBD) characterized by the accumulation of very long- chain fatty acids, adrenal insufficiency and mental retardation. Belongs to the peroxin-13 family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 2p16.1

Cellular Component: integral to peroxisomal membrane; intracellular membrane-bound organelle; membrane; peroxisomal membrane; peroxisome

Molecular Function: protein binding

Biological Process: cerebral cortex cell migration; fatty acid alpha-oxidation; locomotory behavior; microtubule-based peroxisome localization; neuron migration; positive regulation of defense response to virus by host; protein import into peroxisome matrix, docking; suckling behavior

Disease: Peroxisome Biogenesis Disorder 11a (zellweger); Peroxisome Biogenesis Disorder 11b

Research Articles on PEX13

Similar Products

Product Notes

The PEX13 pex13 (Catalog #AAA1268539) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtccc agccgccacc tccccccaaa ccctgggaga cccgccgaat tccgggagcc ggaccgggac caggaccggg ccccactttc caatctgctg atttgggtcc tactttaatg acaagacctg gacaaccagc acttaccaga gtgcccccac ctattcttcc aaggccatca cagcagacag gaagtagcag tgtgaacact tttagacctg cttacagttc attttcttct ggatatggtg cctatggaaa ttcattttat ggaggctata gtccttatag ttatggatat aatgggctgg gctacaaccg cctccgtgta gatgatcttc cacccagtag atttgttcag caagctgaag aaagcagcag gggtgcattt cagtccattg aaagtattgt gcatgcattt gcctctgtca gtatgatgat ggatgctacc ttttcagctg tctataacag tttcagggct gtattggatg tagcaaatca cttttcccga ttgaaaatac actttacaaa agtgttttca gcttttgcat tggttaggac tatacggtat ctttacagac ggctacagcg gatgttaggt ttaagaagag gctctgagaa tgaagacctc tgggcagaga gtgaaggaac tgtggcatgc cttggtgctg aggaccgagc agctacctca gcaaaatctt ggccaatatt cttgttcttt gctgttatcc ttggtggtcc ttacctcatt tggaaactat tgtctactca cagtgatgaa gtaacagaca gcatcaactg ggcaagtggt gaggatgacc atgtagttgc cagagcagaa tatgattttg ctgccgtatc tgaagaagaa atttctttcc gggctggtga tatgctgaac ttagctctca aagaacaaca acccaaagtg cgtggttggc ttctggctag ccttgatggc caaacaacag gacttatacc tgcgaattat gtcaaaattc ttggcaaaag aaaaggtagg aaaacggtgg aatcaagtaa agtttccaag cagcaacaat cttttaccaa cccaacacta actaaaggag ccacggttgc tgattctttg gatgaacagg aagctgcctt tgaatctgtt tttgttgaaa ctaataaggt tccagttgca cctgattcca ttgggaaaga tggagaaaag caagatcttt ga. It is sometimes possible for the material contained within the vial of "PEX13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.