Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RND3 cdna clone

RND3 cDNA Clone

Gene Names
RND3; ARHE; Rho8; RhoE; memB
Synonyms
RND3; RND3 cDNA Clone; RND3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggagagaagagccagccagaaattatccagcaaatctatcatggatcctaatcagaacgtgaaatgcaagatagttgtggtgggagacagtcagtgtggaaaaactgcgctgctccatgtcttcgccaaggactgcttccccgagaattacgttcctacagtgtttgagaattacacggccagttttgaaatcgacacacaaagaatagagttgagcctgtgggacacttcgggttctccttactatgacaatgtccgccccctctcttaccctgattcggatgctgtgctgatttgctttgacatcagtagaccagagaccctggacagtgtcctcaaaaagtggaaaggtgaaatccaggaattttgtccaaataccaaaatgctcttggtcggctgcaagtctgatctgcggacagatgttagtacattagtagagctctccaatcacaggcagacgccagtgtcctatgaccagggggcaaatatggccaaacagattggagcagctacttatatcgaatgctcagctttacagtcggaaaatagcgtcagagacatttttcacgttgccaccttggcatgtgtaaataagacaaataaaaacgttaagcggaacaaatcacagagagccacaaagcggatttcacacatgcctagcagaccagaactctcggcagttgctacggacttacgaaaggacaaagcgaagagctgcactgtgatgtga
Sequence Length
735
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
390
Molecular Weight
27,368 Da
NCBI Official Full Name
Homo sapiens Rho family GTPase 3, mRNA
NCBI Official Synonym Full Names
Rho family GTPase 3
NCBI Official Symbol
RND3
NCBI Official Synonym Symbols
ARHE; Rho8; RhoE; memB
NCBI Protein Information
rho-related GTP-binding protein RhoE
UniProt Protein Name
Rho-related GTP-binding protein RhoE
UniProt Gene Name
RND3
UniProt Synonym Gene Names
ARHE; RHO8; RHOE
UniProt Entry Name
RND3_HUMAN

NCBI Description

This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]

Uniprot Description

RhoE: Binds GTP but lacks intrinsic GTPase activity and is resistant to Rho-specific GTPase-activating proteins. Binds ROCK1. Interacts with UBXD5. Ubiquitous. Belongs to the small GTPase superfamily. Rho family.

Protein type: Motility/polarity/chemotaxis; G protein, monomeric; G protein, monomeric, Rho; G protein

Chromosomal Location of Human Ortholog: 2q23.3

Cellular Component: focal adhesion

Molecular Function: GTPase activity; protein binding

Biological Process: actin cytoskeleton organization and biogenesis; cell adhesion

Research Articles on RND3

Similar Products

Product Notes

The RND3 rnd3 (Catalog #AAA1268516) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggaga gaagagccag ccagaaatta tccagcaaat ctatcatgga tcctaatcag aacgtgaaat gcaagatagt tgtggtggga gacagtcagt gtggaaaaac tgcgctgctc catgtcttcg ccaaggactg cttccccgag aattacgttc ctacagtgtt tgagaattac acggccagtt ttgaaatcga cacacaaaga atagagttga gcctgtggga cacttcgggt tctccttact atgacaatgt ccgccccctc tcttaccctg attcggatgc tgtgctgatt tgctttgaca tcagtagacc agagaccctg gacagtgtcc tcaaaaagtg gaaaggtgaa atccaggaat tttgtccaaa taccaaaatg ctcttggtcg gctgcaagtc tgatctgcgg acagatgtta gtacattagt agagctctcc aatcacaggc agacgccagt gtcctatgac cagggggcaa atatggccaa acagattgga gcagctactt atatcgaatg ctcagcttta cagtcggaaa atagcgtcag agacattttt cacgttgcca ccttggcatg tgtaaataag acaaataaaa acgttaagcg gaacaaatca cagagagcca caaagcggat ttcacacatg cctagcagac cagaactctc ggcagttgct acggacttac gaaaggacaa agcgaagagc tgcactgtga tgtga. It is sometimes possible for the material contained within the vial of "RND3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.