Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPERT cdna clone

SPERT cDNA Clone

Gene Names
SPERT; CBY2; NURIT
Synonyms
SPERT; SPERT cDNA Clone; SPERT cdna clone
Ordering
For Research Use Only!
Sequence
atgcaaccagaggggttgaaatgtaggatggaggaatccaatgcagagaggggcacagccgaacccttcccgaggctccacaacttgtacagcacccctcgctgcgcgcagcaggccgccctgccccggctgagccgcaggatggcgagccagcactcctatccactgaaccgcttctcctccgtgcctttagaccccatggagcgccccatgtcccaggccgacctggagctggactacaacccgccgcgggtgcagctcagcgacgagatgttcgtgttccaggacgggcgctgggtaaatgagaactgccgcctgcagtctccctacttctccccatccgcctccttccaccacaagctgcaccacaagaggctggccaaggagtgcatgctgcaggaggagaacaagtctctgcgggaggagaacaaggccctgcgcgaggagaaccggatgctcagcaaggagaacaagatcctacaggtcttctgggaggagcacaaggcctcgctgggccgagaggagagccgggccccctcgccactgctgcacaaagacagcgcgtccctggaggtggtgaagaaggaccacgtcgccctgcaggtgccccgtggcaaggaggacagcaccctgcagctcctccgggaggagaatcgcgcgctgcagcagctgctggagcagaaacaggcctactgggcgcaggcagaggacacggccgcccctgccgaggaaagcaagcccgccccctcaccccacgaggagccctgcagccccgggctgctgcaggaccagggctccggcctctcctcccgcttcgaggagcccaaagggcctccggcccggcaggaggactccaaggagctgcgcgccctgcggaagatggtcagcaacatgtccgggccctccggggaggaggaggccaaggtgggcccgggcctgcccgacggctgccagcccctgcagctgctgagagagatgaggcaggcgctgcaggccctgctcaaggagaaccggctcctgcaggaggagaacaggaccctgcaggtgctacgggcagagcacaggggcttccaggaggagaacaaggccctgtgggagaacaacaagctgaagctgcagcagaagctggtcattgacaccgtgaccgaggtcaccgcgcgcatggaaatgctcatcgaggagctctacgccttcatgccggccaggagccaggaccccaagaagcctagcagggtctga
Sequence Length
1239
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,289 Da
NCBI Official Full Name
Homo sapiens spermatid associated, mRNA
NCBI Official Synonym Full Names
spermatid associated
NCBI Official Symbol
SPERT
NCBI Official Synonym Symbols
CBY2; NURIT
NCBI Protein Information
spermatid-associated protein
UniProt Protein Name
Spermatid-associated protein
UniProt Gene Name
SPERT
UniProt Synonym Gene Names
CBY2
UniProt Entry Name
SPERT_HUMAN

Uniprot Description

SPERT: Belongs to the chibby family. SPERT subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 13q14.13

Cellular Component: cytoplasmic membrane-bound vesicle

Molecular Function: protein binding

Similar Products

Product Notes

The SPERT spert (Catalog #AAA1268462) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaaccag aggggttgaa atgtaggatg gaggaatcca atgcagagag gggcacagcc gaacccttcc cgaggctcca caacttgtac agcacccctc gctgcgcgca gcaggccgcc ctgccccggc tgagccgcag gatggcgagc cagcactcct atccactgaa ccgcttctcc tccgtgcctt tagaccccat ggagcgcccc atgtcccagg ccgacctgga gctggactac aacccgccgc gggtgcagct cagcgacgag atgttcgtgt tccaggacgg gcgctgggta aatgagaact gccgcctgca gtctccctac ttctccccat ccgcctcctt ccaccacaag ctgcaccaca agaggctggc caaggagtgc atgctgcagg aggagaacaa gtctctgcgg gaggagaaca aggccctgcg cgaggagaac cggatgctca gcaaggagaa caagatccta caggtcttct gggaggagca caaggcctcg ctgggccgag aggagagccg ggccccctcg ccactgctgc acaaagacag cgcgtccctg gaggtggtga agaaggacca cgtcgccctg caggtgcccc gtggcaagga ggacagcacc ctgcagctcc tccgggagga gaatcgcgcg ctgcagcagc tgctggagca gaaacaggcc tactgggcgc aggcagagga cacggccgcc cctgccgagg aaagcaagcc cgccccctca ccccacgagg agccctgcag ccccgggctg ctgcaggacc agggctccgg cctctcctcc cgcttcgagg agcccaaagg gcctccggcc cggcaggagg actccaagga gctgcgcgcc ctgcggaaga tggtcagcaa catgtccggg ccctccgggg aggaggaggc caaggtgggc ccgggcctgc ccgacggctg ccagcccctg cagctgctga gagagatgag gcaggcgctg caggccctgc tcaaggagaa ccggctcctg caggaggaga acaggaccct gcaggtgcta cgggcagagc acaggggctt ccaggaggag aacaaggccc tgtgggagaa caacaagctg aagctgcagc agaagctggt cattgacacc gtgaccgagg tcaccgcgcg catggaaatg ctcatcgagg agctctacgc cttcatgccg gccaggagcc aggaccccaa gaagcctagc agggtctga. It is sometimes possible for the material contained within the vial of "SPERT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.