DPP3 cdna clone
DPP3 cDNA Clone
Gene Names
DPP3; DPPIII
Synonyms
DPP3; DPP3 cDNA Clone; DPP3 cdna clone
Sequence
atggcggacacccagtacatcctgcccaatgacatcggcgtgtctagcctggactgccgtgaggccttccgcctgctgtcacccacagagcgcctctatgcctaccacctgtcccgtgccgcctggtacggaggcctggctgtgctgcttcagacctcccctgaggccccctacatctatgctctgctcagccgcctcttccgcgcccaggaccccgaccagctgcaccaacatgccctggctgaaggccttaccgaggaggagtatcaggcgttcctggtctatgccgcgggtgtttactccaacatgggcaactacaagtcctttggtgacaccaagtttgttcccaacttgcccaaggaaaagctggaacgggtgatcctagggagtgaggctgctcagcagcacccagaagaagtcaggggcctctggcagacctgcggggagcttatgttctctctggagccaaggcttcgacacctcggactggggaaggagggaatcaccacctatttctctgggaattgtaccatggaagatgccaaattggcccaggactttctggactcacagaacctcagtgcctacaacacccggctcttcaaagaggtcgatggagaagggaagccctactacgaggtgcggctggcttctgtgcttggctcagagccttccctggactctgaggtgacttccaagctgaagagctatgaattccggggaagccctttccaggtgacccggggggactacgcgcccatcctccagaaggtggtggagcagctggagaaagccaaggcctatgcagccaacagccaccaggggcagatgctggcccagtatatagagagcttcacccagggctccatcgaggcccacaagaggggctcccgcttctggatccaggacaaaggccccatcgtggagagttacatcgggttcatcgagagctaccgcgacccctttggttcccgaggagaatttgaaggttttgtagctgtggtgaacaaggccatgagtgccaagtttgagcggctggtggcgagcgcagagcagctgctgaaggagctgccctggcccccaacctttgagaaggacaagttcctcacccctgacttcacctccctggatgttctcaccttcgctggctccggcatccctgccggcatcaacatccccaactacgatgatctgaggcagacggaaggctttaagaacgtgtcgctggggaatgtgctggctgtggcctacgccacgcagcgggagaagcttacctttctggaggaggatgacaaggacctgtacatcctctggaaggggccctccttcgatgtgcaggtgggcctgcacgagctgctgggccatggcagtggcaagctcttcgtacaggacgaaaaaggagcattcaactttgaccaggaaacagtgatcaacccagagacgggcgagcagattcagagctggtatcggagcggggagacctgggatagcaagttcagcaccatcgcctccagctacgaagagtgccgggctgagagcgtgggtctctacctctgtctccacccgcaagtgctggagatctttggctttgagggggctgatgcggaggacgtgatctacgtgaactggctcaacatggttcgggccgggctgctcgctctggagttctacacacctgaggccttcaactggcgacaggcccatatgcaggcccggtttgtgatcctgagagtcttgctggaggctggcgagggactcgttaccatcactcccaccacaggctccgatgggcgcccagatgcccgggtccgcctcgaccgcagcaagatccggtctgtgggcaagcctgctctagagcgcttcctgcggagacttcaggtgctgaagtccacaggggatgtggccggagggcgggccctgtacgaggggtatgcaacggtcactgatgcgccccccgagtgcttcctcaccctcagggacacggtgctgctgcgtaaggaatctcggaagctcattgttcagcccaacactcgccttgaaggctcagacgtgcagcttctggaatacgaggcgtcagctgctggcctcatccgatccttctctgagcgtttcccagaggatggacccgagttggaggagatcctcacacagctggccacagccgatgcccgattctggaagggccccagtgaggccccatctggccaagcttga
Sequence Length
2214
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
69,658 Da
NCBI Official Full Name
Homo sapiens dipeptidyl-peptidase 3, mRNA
NCBI Official Synonym Full Names
dipeptidyl peptidase 3
NCBI Official Symbol
DPP3
NCBI Official Synonym Symbols
DPPIII
NCBI Protein Information
dipeptidyl peptidase 3
UniProt Protein Name
Dipeptidyl peptidase 3
UniProt Gene Name
DPP3
UniProt Synonym Gene Names
DPP III
UniProt Entry Name
DPP3_HUMAN
NCBI Description
This gene encodes a protein that is a member of the M49 family of metallopeptidases. This cytoplasmic protein binds a single zinc ion with its zinc-binding motif (HELLGH) and has post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Increased activity of this protein is associated with endometrial and ovarian cancers. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2012]
Uniprot Description
DPP3: Cleaves Arg-Arg-beta-naphthylamide. Belongs to the peptidase M49 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Protease; EC 3.4.14.4
Chromosomal Location of Human Ortholog: 11q13.2
Cellular Component: cytoplasm; nucleoplasm; plasma membrane
Molecular Function: dipeptidyl-peptidase activity; protein binding; zinc ion binding
Biological Process: proteolysis
Research Articles on DPP3
Similar Products
Product Notes
The DPP3 dpp3 (Catalog #AAA1268337) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggaca cccagtacat cctgcccaat gacatcggcg tgtctagcct ggactgccgt gaggccttcc gcctgctgtc acccacagag cgcctctatg cctaccacct gtcccgtgcc gcctggtacg gaggcctggc tgtgctgctt cagacctccc ctgaggcccc ctacatctat gctctgctca gccgcctctt ccgcgcccag gaccccgacc agctgcacca acatgccctg gctgaaggcc ttaccgagga ggagtatcag gcgttcctgg tctatgccgc gggtgtttac tccaacatgg gcaactacaa gtcctttggt gacaccaagt ttgttcccaa cttgcccaag gaaaagctgg aacgggtgat cctagggagt gaggctgctc agcagcaccc agaagaagtc aggggcctct ggcagacctg cggggagctt atgttctctc tggagccaag gcttcgacac ctcggactgg ggaaggaggg aatcaccacc tatttctctg ggaattgtac catggaagat gccaaattgg cccaggactt tctggactca cagaacctca gtgcctacaa cacccggctc ttcaaagagg tcgatggaga agggaagccc tactacgagg tgcggctggc ttctgtgctt ggctcagagc cttccctgga ctctgaggtg acttccaagc tgaagagcta tgaattccgg ggaagccctt tccaggtgac ccggggggac tacgcgccca tcctccagaa ggtggtggag cagctggaga aagccaaggc ctatgcagcc aacagccacc aggggcagat gctggcccag tatatagaga gcttcaccca gggctccatc gaggcccaca agaggggctc ccgcttctgg atccaggaca aaggccccat cgtggagagt tacatcgggt tcatcgagag ctaccgcgac ccctttggtt cccgaggaga atttgaaggt tttgtagctg tggtgaacaa ggccatgagt gccaagtttg agcggctggt ggcgagcgca gagcagctgc tgaaggagct gccctggccc ccaacctttg agaaggacaa gttcctcacc cctgacttca cctccctgga tgttctcacc ttcgctggct ccggcatccc tgccggcatc aacatcccca actacgatga tctgaggcag acggaaggct ttaagaacgt gtcgctgggg aatgtgctgg ctgtggccta cgccacgcag cgggagaagc ttacctttct ggaggaggat gacaaggacc tgtacatcct ctggaagggg ccctccttcg atgtgcaggt gggcctgcac gagctgctgg gccatggcag tggcaagctc ttcgtacagg acgaaaaagg agcattcaac tttgaccagg aaacagtgat caacccagag acgggcgagc agattcagag ctggtatcgg agcggggaga cctgggatag caagttcagc accatcgcct ccagctacga agagtgccgg gctgagagcg tgggtctcta cctctgtctc cacccgcaag tgctggagat ctttggcttt gagggggctg atgcggagga cgtgatctac gtgaactggc tcaacatggt tcgggccggg ctgctcgctc tggagttcta cacacctgag gccttcaact ggcgacaggc ccatatgcag gcccggtttg tgatcctgag agtcttgctg gaggctggcg agggactcgt taccatcact cccaccacag gctccgatgg gcgcccagat gcccgggtcc gcctcgaccg cagcaagatc cggtctgtgg gcaagcctgc tctagagcgc ttcctgcgga gacttcaggt gctgaagtcc acaggggatg tggccggagg gcgggccctg tacgaggggt atgcaacggt cactgatgcg ccccccgagt gcttcctcac cctcagggac acggtgctgc tgcgtaagga atctcggaag ctcattgttc agcccaacac tcgccttgaa ggctcagacg tgcagcttct ggaatacgag gcgtcagctg ctggcctcat ccgatccttc tctgagcgtt tcccagagga tggacccgag ttggaggaga tcctcacaca gctggccaca gccgatgccc gattctggaa gggccccagt gaggccccat ctggccaagc ttga. It is sometimes possible for the material contained within the vial of "DPP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
