Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LAP3 cdna clone

LAP3 cDNA Clone

Gene Names
LAP3; LAP; PEPS; LAPEP; HEL-S-106
Synonyms
LAP3; LAP3 cDNA Clone; LAP3 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcttgctgcctcttccggctgcggggcgagtagtcgtccgacgtctggccgtgagacgtttcgggagccggagtctctccaccgcagacatgacgaagggccttgttttaggaatctattccaaagaaaaagaagatgatgtgccacagttcacaagtgcaggagagaattttgataaattgttagctggaaagctgagagagactttgaacatatctggaccacctctgaaggcagggaagactcgaaccttttatggtctgcatcaggacttccccagcgtggtgctagttggcctcggcaaaaaggcagctggaatcgacgaacaggaaaactggcatgaaggcaaagaaaacatcagagctgctgttgcagcggggtgcaggcagattcaagacctggagctctcgtctgtggaggtggatccctgtggagacgctcaggctgctgcggagggagcggtgcttggtctctatgaatacgatgacctaaagcaaaaaaagaagatggctgtgtcggcaaagctctatggaagtggggatcaggaggcctggcagaaaggagtcctgtttgcttctgggcagaacttggcacgccaattgatggagacgccagccaatgagatgacgccaaccagatttgccgaaattattgagaagaatctcaaaagtgctagtagtaaaaccgaggtccatatcagacccaagtcttggattgaggaacaggcaatgggatcattcctcagtgtggccaaaggatctgacgagcccccagtcttcttggaaattcactacaaaggcagccccaatgcaaacgaaccacccctggtgtttgttgggaaaggaattacctttgacagtggtggtatctccatcaaggcttctgcaaatatggacctcatgagggctgacatgggaggagctgcaactatatgctcagccatcgtgtctgctgcaaagcttaatttgcccattaatattataggtctggcccctctttgtgaaaatatgcccagcggcaaggccaacaagccgggggatgttgttagagccaaaaacgggaagaccatccaggttgataacactgatgctgaggggaggctcatactggctgatgcgctctgttacgcacacacgtttaacccgaaggtcatcctcaatgccgccaccttaacaggtgccatggatgtagctttgggatcaggtgccactggggtctttaccaattcatcctggctctggaacaaactcttcgaggccagcattgaaacaggggaccgtgtctggaggatgcctctcttcgaacattatacaagacaggttgtagattgccagcttgctgatgttaacaacattggaaaatacagatctgcaggagcatgtacagctgcagcattcctgaaagaattcgtaactcatcctaagtgggcacatttagacatagcaggcgtgatgaccaacaaagatgaagttccctatctacggaaaggcatgactgggaggcccacaaggactctcattgagttcttacttcgtttcagtcaagacaatgcttag
Sequence Length
1560
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,771 Da
NCBI Official Full Name
Homo sapiens leucine aminopeptidase 3, mRNA
NCBI Official Synonym Full Names
leucine aminopeptidase 3
NCBI Official Symbol
LAP3
NCBI Official Synonym Symbols
LAP; PEPS; LAPEP; HEL-S-106
NCBI Protein Information
cytosol aminopeptidase
UniProt Protein Name
Cytosol aminopeptidase
Protein Family
UniProt Gene Name
LAP3
UniProt Synonym Gene Names
LAPEP; PEPS; LAP-3
UniProt Entry Name
AMPL_HUMAN

Uniprot Description

LAP3: Presumably involved in the processing and regular turnover of intracellular proteins. Catalyzes the removal of unsubstituted N-terminal amino acids from various peptides. Belongs to the peptidase M17 family. 2 isoforms of the human protein are produced by alternative initiation.

Protein type: Other Amino Acids Metabolism - glutathione; EC 3.4.11.1; EC 3.4.11.5; Mitochondrial; Amino Acid Metabolism - arginine and proline; Protease

Chromosomal Location of Human Ortholog: 4p15.32

Cellular Component: cytoplasm; focal adhesion; nucleoplasm; nucleus

Research Articles on LAP3

Similar Products

Product Notes

The LAP3 lap3 (Catalog #AAA1268292) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcttgc tgcctcttcc ggctgcgggg cgagtagtcg tccgacgtct ggccgtgaga cgtttcggga gccggagtct ctccaccgca gacatgacga agggccttgt tttaggaatc tattccaaag aaaaagaaga tgatgtgcca cagttcacaa gtgcaggaga gaattttgat aaattgttag ctggaaagct gagagagact ttgaacatat ctggaccacc tctgaaggca gggaagactc gaacctttta tggtctgcat caggacttcc ccagcgtggt gctagttggc ctcggcaaaa aggcagctgg aatcgacgaa caggaaaact ggcatgaagg caaagaaaac atcagagctg ctgttgcagc ggggtgcagg cagattcaag acctggagct ctcgtctgtg gaggtggatc cctgtggaga cgctcaggct gctgcggagg gagcggtgct tggtctctat gaatacgatg acctaaagca aaaaaagaag atggctgtgt cggcaaagct ctatggaagt ggggatcagg aggcctggca gaaaggagtc ctgtttgctt ctgggcagaa cttggcacgc caattgatgg agacgccagc caatgagatg acgccaacca gatttgccga aattattgag aagaatctca aaagtgctag tagtaaaacc gaggtccata tcagacccaa gtcttggatt gaggaacagg caatgggatc attcctcagt gtggccaaag gatctgacga gcccccagtc ttcttggaaa ttcactacaa aggcagcccc aatgcaaacg aaccacccct ggtgtttgtt gggaaaggaa ttacctttga cagtggtggt atctccatca aggcttctgc aaatatggac ctcatgaggg ctgacatggg aggagctgca actatatgct cagccatcgt gtctgctgca aagcttaatt tgcccattaa tattataggt ctggcccctc tttgtgaaaa tatgcccagc ggcaaggcca acaagccggg ggatgttgtt agagccaaaa acgggaagac catccaggtt gataacactg atgctgaggg gaggctcata ctggctgatg cgctctgtta cgcacacacg tttaacccga aggtcatcct caatgccgcc accttaacag gtgccatgga tgtagctttg ggatcaggtg ccactggggt ctttaccaat tcatcctggc tctggaacaa actcttcgag gccagcattg aaacagggga ccgtgtctgg aggatgcctc tcttcgaaca ttatacaaga caggttgtag attgccagct tgctgatgtt aacaacattg gaaaatacag atctgcagga gcatgtacag ctgcagcatt cctgaaagaa ttcgtaactc atcctaagtg ggcacattta gacatagcag gcgtgatgac caacaaagat gaagttccct atctacggaa aggcatgact gggaggccca caaggactct cattgagttc ttacttcgtt tcagtcaaga caatgcttag. It is sometimes possible for the material contained within the vial of "LAP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.