SYT16 cdna clone
SYT16 cDNA Clone
Gene Names
SYT16; yt14r; SYT14L; syt14r; Strep14; CHR14SYT
Synonyms
SYT16; SYT16 cDNA Clone; SYT16 cdna clone
Sequence
atggtgttggccatggcgtctcaggatgctcagaacttcttccagcctttctcttcctggatatctcgggtttatgaagctctccagcaagcaggagatatgttatctgcttcgctggttaacataagcaaacaagactctaaattgagtgacaaactagatcaggacttagataatattcagattcaggaaacgtactttgaagatgaagaacaagacaatgattggagtcaagaggatgcaaattccttgtttcttgaagtggatcatttctcatgttgtaatagtgatttgcaggactctgcccaaaattcaagcccaagccttagccaacatgcaaaggactcatgttccacaatgtcccagtggcccaattgggccagtgatgaccgcaagttaccacatgtgctttcttctattgcggaggaagagcatcaccttgaaaagcaaagaagtggccttcaacatggctttgacagccagctccctggtactttagaaactgttaatggaaaaaagcaagtcaacagctttggggatgacgaagagctgtccacatcttctgacagtgacgaggaggtgatcaaacaatttgagatttccgtgtcccggtcccagagtttccgttcagtgacatctgagaaaggaaagcagacaggattggagcagaaaccaaaattcagccgttcgttgttgacacacggagaagatggcacagaagtatctgcctgcgaagatttggatggagccagccaacggcgttattctgagaatctctcctacggtgaagatgaccacatccctgctcactcacagtccccatgtgaaagaggggatgccaaacaccacggcacatctcaccaagagtccagtgtggtccaaagcctcaggcgccaatccacagagggcagcttggagatggagacagcttttaatagccggggatttgaagattcctatgccactgacagctcctccatgtggagtccagaggaacaggacaggaccaatttgcaggtgccatccggggtctcagagcccatctcaaagtgtggtgacctagatgtcatctttgaatatagagccgccagccagaagctcacagtgaccattgtgagggcacagggcctcccagataaggaccgaagtggtgtcaactcctggcaagttcatgtagtgctgctgcctggtaagaaacacaggggcaggacgaacatacagagagggcccaaccccgtcttcagggagaaggtcacctttgccaagctggagcccagagatgtggctgcctgtgctgtccgcttccgcctgtacgctgcccggaagatgacccgagagagaatgatgggagagaaactattctatctcagccacctgcacccagaaggggaaatgaaagtgactctggttctggagccaagaagtaatataagcagtggagggtctccgctcagcccatctgcggtttctcacagtgatagtacttcatccacgcagtcgctgtctcatggaggggcgccagagctgttggtggggctctcgtacaatgccacaacggggcgattatctgtggaaatgatcaaaggcagccatttccgaaacctcgctgttaaccgagcacctgatacatatggaaaactctttctcctcaattctgtgggtcaagagatgtcccgttgcaagacgtccattcggcgtggtcagcccaatcctgtctataaggagacctttgttttccaggtggccctctttcagctgtctgatgtcacgttgatgatttccgtttataacaggcgtactatgaagcgtaaagagatgattggctggattgccctgggccagaacagcagtggagaggaggaacaagatcactgggaggagatgaaggaaaccaaaggccagcagatctgcagatggcacactttgctggaatcctag
Sequence Length
1938
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,800 Da
NCBI Official Full Name
Homo sapiens synaptotagmin XVI, mRNA
NCBI Official Synonym Full Names
synaptotagmin 16
NCBI Official Symbol
SYT16
NCBI Official Synonym Symbols
yt14r; SYT14L; syt14r; Strep14; CHR14SYT
NCBI Protein Information
synaptotagmin-16
UniProt Protein Name
Synaptotagmin-16
Protein Family
UniProt Gene Name
SYT16
UniProt Synonym Gene Names
STREP14; SYT14L; SYT14R
UniProt Entry Name
SYT16_HUMAN
Uniprot Description
SYT16: May be involved in the trafficking and exocytosis of secretory vesicles in non-neuronal tissues. Is Ca(2+)-independent. Belongs to the synaptotagmin family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Lipid-binding
Chromosomal Location of Human Ortholog: 14q23.2
Cellular Component: plasma membrane
Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; clathrin binding; protein binding; syntaxin binding
Biological Process: calcium ion-dependent exocytosis of neurotransmitter; regulation of calcium ion-dependent exocytosis; vesicle fusion
Research Articles on SYT16
Similar Products
Product Notes
The SYT16 syt16 (Catalog #AAA1268285) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgttgg ccatggcgtc tcaggatgct cagaacttct tccagccttt ctcttcctgg atatctcggg tttatgaagc tctccagcaa gcaggagata tgttatctgc ttcgctggtt aacataagca aacaagactc taaattgagt gacaaactag atcaggactt agataatatt cagattcagg aaacgtactt tgaagatgaa gaacaagaca atgattggag tcaagaggat gcaaattcct tgtttcttga agtggatcat ttctcatgtt gtaatagtga tttgcaggac tctgcccaaa attcaagccc aagccttagc caacatgcaa aggactcatg ttccacaatg tcccagtggc ccaattgggc cagtgatgac cgcaagttac cacatgtgct ttcttctatt gcggaggaag agcatcacct tgaaaagcaa agaagtggcc ttcaacatgg ctttgacagc cagctccctg gtactttaga aactgttaat ggaaaaaagc aagtcaacag ctttggggat gacgaagagc tgtccacatc ttctgacagt gacgaggagg tgatcaaaca atttgagatt tccgtgtccc ggtcccagag tttccgttca gtgacatctg agaaaggaaa gcagacagga ttggagcaga aaccaaaatt cagccgttcg ttgttgacac acggagaaga tggcacagaa gtatctgcct gcgaagattt ggatggagcc agccaacggc gttattctga gaatctctcc tacggtgaag atgaccacat ccctgctcac tcacagtccc catgtgaaag aggggatgcc aaacaccacg gcacatctca ccaagagtcc agtgtggtcc aaagcctcag gcgccaatcc acagagggca gcttggagat ggagacagct tttaatagcc ggggatttga agattcctat gccactgaca gctcctccat gtggagtcca gaggaacagg acaggaccaa tttgcaggtg ccatccgggg tctcagagcc catctcaaag tgtggtgacc tagatgtcat ctttgaatat agagccgcca gccagaagct cacagtgacc attgtgaggg cacagggcct cccagataag gaccgaagtg gtgtcaactc ctggcaagtt catgtagtgc tgctgcctgg taagaaacac aggggcagga cgaacataca gagagggccc aaccccgtct tcagggagaa ggtcaccttt gccaagctgg agcccagaga tgtggctgcc tgtgctgtcc gcttccgcct gtacgctgcc cggaagatga cccgagagag aatgatggga gagaaactat tctatctcag ccacctgcac ccagaagggg aaatgaaagt gactctggtt ctggagccaa gaagtaatat aagcagtgga gggtctccgc tcagcccatc tgcggtttct cacagtgata gtacttcatc cacgcagtcg ctgtctcatg gaggggcgcc agagctgttg gtggggctct cgtacaatgc cacaacgggg cgattatctg tggaaatgat caaaggcagc catttccgaa acctcgctgt taaccgagca cctgatacat atggaaaact ctttctcctc aattctgtgg gtcaagagat gtcccgttgc aagacgtcca ttcggcgtgg tcagcccaat cctgtctata aggagacctt tgttttccag gtggccctct ttcagctgtc tgatgtcacg ttgatgattt ccgtttataa caggcgtact atgaagcgta aagagatgat tggctggatt gccctgggcc agaacagcag tggagaggag gaacaagatc actgggagga gatgaaggaa accaaaggcc agcagatctg cagatggcac actttgctgg aatcctag. It is sometimes possible for the material contained within the vial of "SYT16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
