Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EGFLAM cdna clone

EGFLAM cDNA Clone

Gene Names
EGFLAM; PIKA; AGRNL; AGRINL
Synonyms
EGFLAM; EGFLAM cDNA Clone; EGFLAM cdna clone
Ordering
For Research Use Only!
Sequence
atggatttaatccgaggcgtcttgctccggctcctgctcctggcttccagcctcggacccggcgcggtgtcgctccgagcggccatccgaaaaccaggcaaggtagggcctcctcttgacatcaagctgggcgcattgaactgtacggctttcagcatccagtggaaaatgccaaggcatcctggaagtcccatccttgggtacactgtcttttactctgaggttggcgcagataaatccctgcaggagcagttgcacagcgtgcctctcagccgggacatcccgaccacggaggaagtgattggagatttgaaaccaggcactgaatatcgtgtgagcatagcagcttacagccaggctggcaaagggcggctgagctctcctcggcatgtcaccactttgtcccaagattcctgcctgcctcctgcagctccccagcagccacatgtcattgtggtttcggattctgaggtggccctgtcttggaaacctggagcgagtgaaggaagcgcccctattcagtactattctgtggaattcatcaggccagatttcgacaagaagtggacctcaatccatgagcggatccagatggactccatggttatcaagggcctcgatccagataccaactaccagtttgccgtgagggcaatgaattcccatggccccagcccccgcagctggcccagtgacatcatccggaccctctgccctgaggaggcgggaagtggccgctatggaccccgttatatcaccgacatgggagctggtgaggatgatgaaggatttgaagacgacttagatttggatatttcctttgaggaggttaaaccacttcctgctaccaaaggagggaataagaaatttttggtggaaagcaagaagatgtctatatctaacccaaagaccatttctaggctcatcccccctacctcagcatctctccctgtgaccacggtggctccccagcccattcccatacagagaaaggggaagaatggtgtggccataatgtcaaggctctttgacatgccttgtgatgaaactctctgctctgctgacagcttctgtgtcaatgactacacctgggggggctcgcgatgccagtgcaccctgggcaaaggtggtgagagctgctcagaagatattgttatccagtatcctcagttctttggccactcctatgtaacgtttgaacctctgaagaattcttatcaggcatttcaaattactcttgaatttagggcggaggcagaggatggcttactgctctactgtggggagaacgaacacgggaggggggatttcatgtccctggctatcatccgacgctccctgcagttcaggtttaattgtggaactggggttgccatcatcgtaagtgagaccaaaatcaaactagggggttggcacatggttatgctctacagagatgggctgaacgggctgctgcagctgaacaatggcaccccagtgacaggccagtctcagggccaatacagtaaaattactttccggacacctctctatcttggtggcgctcccagcgcttactggttggttagagcaacagggacaaaccgaggctttcaaggctgtgtgcagtcgctcgctgtgaatgggaggagaattgacatgaggccctggcccctgggaaaagcactcagtggggctgatgtgggggaatgcagcagtggaatctgtgatgaggcctcgtgcatccatggtggcacctgcacagcaatcaaagccgactcctacatttgcctctgtccccttgggtttaaaggtcgacactgtgaagatgctttcaccttgaccattcctcagttcagagagtctctgagatcttacgctgcaactccctggccactggagccccagcattacctttccttcatggaatttgagatcacatttcggccagactcaggagatggtgtcctcctgtacagctatgacacaggcagcaaagacttcctgtccatcaacttggcagggggccacgtggagttccgctttgactgtggctctgggaccggtgtcctcaggagtgaagatcccctcaccctgggcaactggcacgagcttcgtgtatctcgcacagcaaagaatggaatcttacaggtggataagcagaagatagtggagggaatggcagagggaggcttcacacagattaagtgcaacacagacattttcattggcggagtccccaattatgatgatgtgaagaagaactcgggtgtcctgaagcctttcagcgggagcatccagaagatcatcctgaatgaccgaaccatccatgtgaagcatgacttcacctccggagtgaatgtggagaatgcggcccacccctgtgtgagagccccttgtgcccatgggggcagctgccggcccaggaaggagggctatgactgtgactgccccttgggctttgaggggcttcactgccagaaagcgatcatagaagccattgagatcccgcagtttatcggccgcagttacctgacgtatgacaacccagatatcttgaagagggtgtcaggatcaagatcaaatgtgttcatgaggtttaaaacaactgccaaggatggccttttgctgtggaggggagacagccccatgagacccaacagcgacttcatttccttgggccttcgggatggagccctcgtgttcagctataacctgggcagtggtgtggcatccatcatggtgaatggctccttcaacgatggtcggtggcaccgagttaaggccgttagggatggccagtcaggaaagataaccgtggatgactatggagccagaacaggcaaatccccaggcatgatgcggcagcttaacatcaatggagctctgtatgtgggtggaatgaaggaaattgctctgcacactaacaggcaatatatgagagggctcgtgggctgtatctctcacttcaccctgtccaccgattaccacatttccctcgtggaagatgccgtggatggaaaaaacatcaacacttgtggagccaagtaa
Sequence Length
3030
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,588 Da
NCBI Official Full Name
Homo sapiens EGF-like, fibronectin type III and laminin G domains, mRNA
NCBI Official Synonym Full Names
EGF like, fibronectin type III and laminin G domains
NCBI Official Symbol
EGFLAM
NCBI Official Synonym Symbols
PIKA; AGRNL; AGRINL
NCBI Protein Information
pikachurin
UniProt Protein Name
Pikachurin
Protein Family
UniProt Gene Name
EGFLAM
UniProt Synonym Gene Names
AGRINL; AGRNL
UniProt Entry Name
EGFLA_HUMAN

Uniprot Description

EGFLAM: Involved in both the retinal photoreceptor ribbon synapse formation and physiological functions of visual perception. Necessary for proper bipolar dendritic tip apposition to the photoreceptor ribbon synapse. Promotes matrix assembly and cell adhesiveness. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 5p13.2-p13.1

Research Articles on EGFLAM

Similar Products

Product Notes

The EGFLAM egflam (Catalog #AAA1268267) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatttaa tccgaggcgt cttgctccgg ctcctgctcc tggcttccag cctcggaccc ggcgcggtgt cgctccgagc ggccatccga aaaccaggca aggtagggcc tcctcttgac atcaagctgg gcgcattgaa ctgtacggct ttcagcatcc agtggaaaat gccaaggcat cctggaagtc ccatccttgg gtacactgtc ttttactctg aggttggcgc agataaatcc ctgcaggagc agttgcacag cgtgcctctc agccgggaca tcccgaccac ggaggaagtg attggagatt tgaaaccagg cactgaatat cgtgtgagca tagcagctta cagccaggct ggcaaagggc ggctgagctc tcctcggcat gtcaccactt tgtcccaaga ttcctgcctg cctcctgcag ctccccagca gccacatgtc attgtggttt cggattctga ggtggccctg tcttggaaac ctggagcgag tgaaggaagc gcccctattc agtactattc tgtggaattc atcaggccag atttcgacaa gaagtggacc tcaatccatg agcggatcca gatggactcc atggttatca agggcctcga tccagatacc aactaccagt ttgccgtgag ggcaatgaat tcccatggcc ccagcccccg cagctggccc agtgacatca tccggaccct ctgccctgag gaggcgggaa gtggccgcta tggaccccgt tatatcaccg acatgggagc tggtgaggat gatgaaggat ttgaagacga cttagatttg gatatttcct ttgaggaggt taaaccactt cctgctacca aaggagggaa taagaaattt ttggtggaaa gcaagaagat gtctatatct aacccaaaga ccatttctag gctcatcccc cctacctcag catctctccc tgtgaccacg gtggctcccc agcccattcc catacagaga aaggggaaga atggtgtggc cataatgtca aggctctttg acatgccttg tgatgaaact ctctgctctg ctgacagctt ctgtgtcaat gactacacct gggggggctc gcgatgccag tgcaccctgg gcaaaggtgg tgagagctgc tcagaagata ttgttatcca gtatcctcag ttctttggcc actcctatgt aacgtttgaa cctctgaaga attcttatca ggcatttcaa attactcttg aatttagggc ggaggcagag gatggcttac tgctctactg tggggagaac gaacacggga ggggggattt catgtccctg gctatcatcc gacgctccct gcagttcagg tttaattgtg gaactggggt tgccatcatc gtaagtgaga ccaaaatcaa actagggggt tggcacatgg ttatgctcta cagagatggg ctgaacgggc tgctgcagct gaacaatggc accccagtga caggccagtc tcagggccaa tacagtaaaa ttactttccg gacacctctc tatcttggtg gcgctcccag cgcttactgg ttggttagag caacagggac aaaccgaggc tttcaaggct gtgtgcagtc gctcgctgtg aatgggagga gaattgacat gaggccctgg cccctgggaa aagcactcag tggggctgat gtgggggaat gcagcagtgg aatctgtgat gaggcctcgt gcatccatgg tggcacctgc acagcaatca aagccgactc ctacatttgc ctctgtcccc ttgggtttaa aggtcgacac tgtgaagatg ctttcacctt gaccattcct cagttcagag agtctctgag atcttacgct gcaactccct ggccactgga gccccagcat tacctttcct tcatggaatt tgagatcaca tttcggccag actcaggaga tggtgtcctc ctgtacagct atgacacagg cagcaaagac ttcctgtcca tcaacttggc agggggccac gtggagttcc gctttgactg tggctctggg accggtgtcc tcaggagtga agatcccctc accctgggca actggcacga gcttcgtgta tctcgcacag caaagaatgg aatcttacag gtggataagc agaagatagt ggagggaatg gcagagggag gcttcacaca gattaagtgc aacacagaca ttttcattgg cggagtcccc aattatgatg atgtgaagaa gaactcgggt gtcctgaagc ctttcagcgg gagcatccag aagatcatcc tgaatgaccg aaccatccat gtgaagcatg acttcacctc cggagtgaat gtggagaatg cggcccaccc ctgtgtgaga gccccttgtg cccatggggg cagctgccgg cccaggaagg agggctatga ctgtgactgc cccttgggct ttgaggggct tcactgccag aaagcgatca tagaagccat tgagatcccg cagtttatcg gccgcagtta cctgacgtat gacaacccag atatcttgaa gagggtgtca ggatcaagat caaatgtgtt catgaggttt aaaacaactg ccaaggatgg ccttttgctg tggaggggag acagccccat gagacccaac agcgacttca tttccttggg ccttcgggat ggagccctcg tgttcagcta taacctgggc agtggtgtgg catccatcat ggtgaatggc tccttcaacg atggtcggtg gcaccgagtt aaggccgtta gggatggcca gtcaggaaag ataaccgtgg atgactatgg agccagaaca ggcaaatccc caggcatgat gcggcagctt aacatcaatg gagctctgta tgtgggtgga atgaaggaaa ttgctctgca cactaacagg caatatatga gagggctcgt gggctgtatc tctcacttca ccctgtccac cgattaccac atttccctcg tggaagatgc cgtggatgga aaaaacatca acacttgtgg agccaagtaa. It is sometimes possible for the material contained within the vial of "EGFLAM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.