Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TGFBI cdna clone

TGFBI cDNA Clone

Gene Names
TGFBI; CSD; CDB1; CDG2; CSD1; CSD2; CSD3; EBMD; LCD1; BIGH3; CDGG1
Synonyms
TGFBI; TGFBI cDNA Clone; TGFBI cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctcttcgtgcggctgctggctctcgccctggctctggccctgggccccgccgcgaccctggcgggtcccgccaagtcgccctaccagctggtgctgcagcacagcaggctccggggccgccagcacggccccaacgtgtgtgctgtgcagaaggttattggcactaataggaagtacttcaccaactgcaagcagtggtaccaaaggaaaatctgtggcaaatcaacagtcatcagctacgagtgctgtcctggatatgaaaaggtccctggggagaagggctgtccagcagccctaccactctcaaacctttacgagaccctgggagtcgttggatccaccaccactcagctgtacacggaccgcacggagaagctgaggcctgagatggaggggcccggcagcttcaccatcttcgcccctagcaacgaggcctgggcctccttgccagctgaagtgctggactccctggtcagcaatgtcaacattgagctgctcaatgccctccgctaccatatggtgggcaggcgagtcctgactgatgagctgaaacacggcatgaccctcacctctatgtaccagaattccaacatccagatccaccactatcctaatgggattgtaactgtgaactgtgcccggctgctgaaagccgaccaccatgcaaccaacggggtggtgcacctcatcgataaggtcatctccaccatcaccaacaacatccagcagatcattgagatcgaggacacctttgagacccttcgggctgctgtggctgcatcagggctcaacacgatgcttgaaggcaacggccagtacacgcttttggccccgaccaatgaggccttcgagaagatccctagtgagactttgaaccgtatcctgggcgacccagaagccctgagagacctgctgaacaaccacatcttgaagtcagctatgtgtgctgaagccatcgttgcggggctgtctgtggagaccctggagggcacgacactggaggtgggctgcagcggggacatgctcactatcaacgggaaggcgatcatctccaataaagacatcctagccaccaacggggtgatccactacattgatgagctactcatcccagactcagccaagacactatttgaattggctgcagagtctgatgtgtccacagccattgaccttttcagacaagccggcctcggcaatcatctctctggaagtgagcggttgaccctcctggctcccctgaattctgtattcaaagatggaacccctccaattgatgcccatacaaggaatttgcttcggaaccacataattaaagaccagctggcctctaagtatctgtaccatggacagaccctggaaactctgggcggcaaaaaactgagagtttttgtttatcgtaatagcctttgcattgagaacagctgcatcgcggcccacgacaagagggggaggtacgggaccctgttcacgatggaccgggtgctgacccccccaatggggactgtcatggatgtcctgaagggagacaatcgctttagcatgctggtagctgccatccagtctgcaggactgacggagaccctcaaccgggaaggagtctacacagtcttcgctcccacaaatgaagccttccgagccctgccaccaagagaacggagcagactcttgggagatgccaaggaacttgccaacatcctgaaataccacattggtgatgaaatcctggttagcggaggcatcggggccctggtgcggctaaagtctctccaaggtgacaagctggaagtcagcttgaaaaacaatgtggtgagtgtcaacaaggagcctgttgccgagcctgacatcatggccacaaatggcgtggtccatgtcatcaccaatgttctgcagcctccagccaacagacctcaggaaagaggggatgaacttgcagactctgcgcttgagatcttcaaacaagcatcagcgttttccagggcttcccagaggtctgtgcgactagcccctgtctatcaaaagttattagagaggatgaagcattag
Sequence Length
2052
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,681 Da
NCBI Official Full Name
Homo sapiens transforming growth factor, beta-induced, 68kDa, mRNA
NCBI Official Synonym Full Names
transforming growth factor beta induced
NCBI Official Symbol
TGFBI
NCBI Official Synonym Symbols
CSD; CDB1; CDG2; CSD1; CSD2; CSD3; EBMD; LCD1; BIGH3; CDGG1
NCBI Protein Information
transforming growth factor-beta-induced protein ig-h3
UniProt Protein Name
Transforming growth factor-beta-induced protein ig-h3
UniProt Gene Name
TGFBI
UniProt Synonym Gene Names
BIGH3; Beta ig-h3; RGD-CAP
UniProt Entry Name
BGH3_HUMAN

NCBI Description

This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq, Jul 2008]

Uniprot Description

betaIG-H3: Binds to type I, II, and IV collagens. This adhesion protein may play an important role in cell-collagen interactions. In cartilage, may be involved in endochondral bone formation. By TGFB1. Highly expressed in the corneal epithelium.

Protein type: Extracellular matrix; Secreted; Secreted, signal peptide; Cell adhesion

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: extracellular matrix; extracellular region; extracellular space; plasma membrane; proteinaceous extracellular matrix; trans-Golgi network

Molecular Function: collagen binding; protein binding

Biological Process: angiogenesis; cellular protein metabolic process; extracellular matrix organization and biogenesis; negative regulation of cell adhesion

Disease: Corneal Dystrophy Of Bowman Layer, Type I; Corneal Dystrophy Of Bowman Layer, Type Ii; Corneal Dystrophy, Avellino Type; Corneal Dystrophy, Epithelial Basement Membrane; Corneal Dystrophy, Groenouw Type I; Corneal Dystrophy, Lattice Type I; Corneal Dystrophy, Lattice Type Iiia

Research Articles on TGFBI

Similar Products

Product Notes

The TGFBI tgfbi (Catalog #AAA1268259) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctct tcgtgcggct gctggctctc gccctggctc tggccctggg ccccgccgcg accctggcgg gtcccgccaa gtcgccctac cagctggtgc tgcagcacag caggctccgg ggccgccagc acggccccaa cgtgtgtgct gtgcagaagg ttattggcac taataggaag tacttcacca actgcaagca gtggtaccaa aggaaaatct gtggcaaatc aacagtcatc agctacgagt gctgtcctgg atatgaaaag gtccctgggg agaagggctg tccagcagcc ctaccactct caaaccttta cgagaccctg ggagtcgttg gatccaccac cactcagctg tacacggacc gcacggagaa gctgaggcct gagatggagg ggcccggcag cttcaccatc ttcgccccta gcaacgaggc ctgggcctcc ttgccagctg aagtgctgga ctccctggtc agcaatgtca acattgagct gctcaatgcc ctccgctacc atatggtggg caggcgagtc ctgactgatg agctgaaaca cggcatgacc ctcacctcta tgtaccagaa ttccaacatc cagatccacc actatcctaa tgggattgta actgtgaact gtgcccggct gctgaaagcc gaccaccatg caaccaacgg ggtggtgcac ctcatcgata aggtcatctc caccatcacc aacaacatcc agcagatcat tgagatcgag gacacctttg agacccttcg ggctgctgtg gctgcatcag ggctcaacac gatgcttgaa ggcaacggcc agtacacgct tttggccccg accaatgagg ccttcgagaa gatccctagt gagactttga accgtatcct gggcgaccca gaagccctga gagacctgct gaacaaccac atcttgaagt cagctatgtg tgctgaagcc atcgttgcgg ggctgtctgt ggagaccctg gagggcacga cactggaggt gggctgcagc ggggacatgc tcactatcaa cgggaaggcg atcatctcca ataaagacat cctagccacc aacggggtga tccactacat tgatgagcta ctcatcccag actcagccaa gacactattt gaattggctg cagagtctga tgtgtccaca gccattgacc ttttcagaca agccggcctc ggcaatcatc tctctggaag tgagcggttg accctcctgg ctcccctgaa ttctgtattc aaagatggaa cccctccaat tgatgcccat acaaggaatt tgcttcggaa ccacataatt aaagaccagc tggcctctaa gtatctgtac catggacaga ccctggaaac tctgggcggc aaaaaactga gagtttttgt ttatcgtaat agcctttgca ttgagaacag ctgcatcgcg gcccacgaca agagggggag gtacgggacc ctgttcacga tggaccgggt gctgaccccc ccaatgggga ctgtcatgga tgtcctgaag ggagacaatc gctttagcat gctggtagct gccatccagt ctgcaggact gacggagacc ctcaaccggg aaggagtcta cacagtcttc gctcccacaa atgaagcctt ccgagccctg ccaccaagag aacggagcag actcttggga gatgccaagg aacttgccaa catcctgaaa taccacattg gtgatgaaat cctggttagc ggaggcatcg gggccctggt gcggctaaag tctctccaag gtgacaagct ggaagtcagc ttgaaaaaca atgtggtgag tgtcaacaag gagcctgttg ccgagcctga catcatggcc acaaatggcg tggtccatgt catcaccaat gttctgcagc ctccagccaa cagacctcag gaaagagggg atgaacttgc agactctgcg cttgagatct tcaaacaagc atcagcgttt tccagggctt cccagaggtc tgtgcgacta gcccctgtct atcaaaagtt attagagagg atgaagcatt ag. It is sometimes possible for the material contained within the vial of "TGFBI, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.