SH3GLB2 cdna clone
SH3GLB2 cDNA Clone
Gene Names
SH3GLB2; RRIG1; PP6569; PP9455
Synonyms
SH3GLB2; SH3GLB2 cDNA Clone; SH3GLB2 cdna clone
Sequence
atggacttcaacatgaagaagctggcgtcggacgcgggcatcttcttcacccgggcggtgcagttcacggaggagaaatttggccaggctgagaagactgagcttgatgcccactttgaaaaccttctggcccgggcagacagcaccaagaactggacagagaagatcttgaggcagacagaggtgctgctgcagcccaaccccagtgcccgagtggaggagttcctgtatgagaagctggacaggaaggtcccctcaagggtcaccaacggggagctgctggctcagtacatggcagacgcggccagtgagctggggccgaccaccccctatgggaagacactgatcaaggtggcagaagctgaaaagcaactgggagccgcggagagggattttatccacacggcctccatcagcttcctcacacccttgcgcaacttcctggagggggactggaagaccatctcgaaggagaggcggctcctccaaaaccggcgtctggacttggatgcctgcaaagcgaggctgaagaaggccaaggctgcagaagccaaagccacgacggtgcctgactttcaggagactagacctcgtaattacattctctcggccagcgcctccgcgctctggaatgatgaagtggacaaggccgagcaggagctccgcgtggcccagacagagtttgaccggcaagcagaagtgacccgtctcttgctggagggaatcagtagcactcacgtgaaccacctgcgctgcctccacgagttcgtcaagtctcagacaacctactacgcacagtgctaccgccacatgctggacttgcagaagcagctgggcagatttcccggcaccttcgtgggcaccacagagcccgcctccccacccctgagcagcacctcacccaccactgctgcggccactatgcctgtggtgccctctgtggccagcctggcccctccaggggaggcctcgctctgcctggaagaggtggccccccctgccagtgggacccgcaaagctcgggtgctctatgactacgaggcagccgacagcagtgagctggccctgctggctgatgagctcatcactgtctacagcctgcctggcatggaccctgactggctcattggcgagagaggcaacaagaagggcaaggtccctgtcacctacttggaactgctcagctag
Sequence Length
1188
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,766 Da
NCBI Official Full Name
Homo sapiens SH3-domain GRB2-like endophilin B2, mRNA
NCBI Official Synonym Full Names
SH3 domain containing GRB2 like endophilin B2
NCBI Official Symbol
SH3GLB2
NCBI Official Synonym Symbols
RRIG1; PP6569; PP9455
NCBI Protein Information
endophilin-B2
UniProt Protein Name
Endophilin-B2
Protein Family
UniProt Gene Name
SH3GLB2
UniProt Synonym Gene Names
KIAA1848
UniProt Entry Name
SHLB2_HUMAN
Uniprot Description
SH3GLB2: Belongs to the endophilin family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Autophagy
Chromosomal Location of Human Ortholog: 9q34
Cellular Component: cell-cell adherens junction; cytoplasm; nucleus
Molecular Function: identical protein binding; protein binding
Research Articles on SH3GLB2
Similar Products
Product Notes
The SH3GLB2 sh3glb2 (Catalog #AAA1268189) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacttca acatgaagaa gctggcgtcg gacgcgggca tcttcttcac ccgggcggtg cagttcacgg aggagaaatt tggccaggct gagaagactg agcttgatgc ccactttgaa aaccttctgg cccgggcaga cagcaccaag aactggacag agaagatctt gaggcagaca gaggtgctgc tgcagcccaa ccccagtgcc cgagtggagg agttcctgta tgagaagctg gacaggaagg tcccctcaag ggtcaccaac ggggagctgc tggctcagta catggcagac gcggccagtg agctggggcc gaccaccccc tatgggaaga cactgatcaa ggtggcagaa gctgaaaagc aactgggagc cgcggagagg gattttatcc acacggcctc catcagcttc ctcacaccct tgcgcaactt cctggagggg gactggaaga ccatctcgaa ggagaggcgg ctcctccaaa accggcgtct ggacttggat gcctgcaaag cgaggctgaa gaaggccaag gctgcagaag ccaaagccac gacggtgcct gactttcagg agactagacc tcgtaattac attctctcgg ccagcgcctc cgcgctctgg aatgatgaag tggacaaggc cgagcaggag ctccgcgtgg cccagacaga gtttgaccgg caagcagaag tgacccgtct cttgctggag ggaatcagta gcactcacgt gaaccacctg cgctgcctcc acgagttcgt caagtctcag acaacctact acgcacagtg ctaccgccac atgctggact tgcagaagca gctgggcaga tttcccggca ccttcgtggg caccacagag cccgcctccc cacccctgag cagcacctca cccaccactg ctgcggccac tatgcctgtg gtgccctctg tggccagcct ggcccctcca ggggaggcct cgctctgcct ggaagaggtg gccccccctg ccagtgggac ccgcaaagct cgggtgctct atgactacga ggcagccgac agcagtgagc tggccctgct ggctgatgag ctcatcactg tctacagcct gcctggcatg gaccctgact ggctcattgg cgagagaggc aacaagaagg gcaaggtccc tgtcacctac ttggaactgc tcagctag. It is sometimes possible for the material contained within the vial of "SH3GLB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
