Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF334 cdna clone

ZNF334 cDNA Clone

Synonyms
ZNF334; ZNF334 cDNA Clone; ZNF334 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaaatgaaaaaatttcagataccagtttcattccaggacctgactgtgaacttcacccaagaggaatggcagcaactggaccctgctcagaggctcctgtacagggatgtgatgctggagaactacagcaacttggtctctgtggggtatcatgttagcaaaccagatgtgattttcaaattggagcaaggagaagagccatggatagtggaggaattctcaaatcagaactacccagacattgatgatgccttagagaagaacaaggaaatccaagataaacatttgacacaaactgtattcttcagcaacaaaacactgattacagaaagagagaatgtatttgggaaaacacttaatctgggcatgaatagtgttccctcaagaaaaatgccctataaatgtaatccaggaggaaacagtttgaaaactaattcagaagtaattgttgcaaagaaaagcaaagaaaacagaaagattcctgatggatacagtggatttgggaagcatgagaaaagtcatttgggaatgaaaaaatacagatacaatccaatgaggaaagccagcaatcaaaacgaaaatcttattctgcaccagaacattcagattttgaaacaaccgtttgactataataaatgtgggaaaaccttcttcaagagggcaattctcattacacaaaaggggagacagactgaaaggaaaccaaatgaatgtaatgaatgtaggaaaaccttttctaagagatctaccctcattgtacatcagagaattcatacaggggagaaaccgtatgtttgtagtgattgtaggaaaacttttcgtgtgaagacaagcctcactcgacaccgaagaattcatactggagagagaccctatgaatgcagtgaatgcaggaaaaccttcattgacaaatctgcccttattgtacaccagaaaattcatggaggggagaaatcctatgagtgtaatgaatgtggaaagaccttttttcggaagtcagccctggctgaacatttcaggtcacacacaggggagaagccttacgaatgcaaggaatgtggaaatgccttcagcaagaaatcgtatcttgttgtacatcaaagaactcacagaggagagaagccaaatgaatgtaaggaatgtgggaaaaccttcttctgtcagtcagcccttactgcgcatcagagaattcacacaggggaaaaaccctatgaatgtagtgaatgtgagaaaaccttcttttgtcaatctgccctcaatgtgcatcgaagaagtcatacaggagagaagccctatgaatgcagtcaatgtggaaaatttttatgtacgaaatcagccctcattgcacatcagataactcatagaggaaagaagtcttatgaatgtaatgaatgtgggaaatttttctgccataagtcaacactcactatacatcagagaacacacacaggagagaaacatggtgtgtttaataaatgtggtagaatctccattgtgaagtcaaactgcagtcagtgtaagagaatgaacacaaaggagaatctttatgagtgtagtgaacatgggcatgccgtcagcaaaaactcacacctcattgtacatcagagaactatatgggagagaccatatgaatgcaatgaatgtgggagaacctactgcaggaagtcagccctgactcaccatcagagaacacacacaggacagagaccctatgagtgtaatgaatgtgggaaaaccttctgtcagaagttctcctttgttgaacatcagcgaactcacactggggagaaaccatatgaatgtaatgaatgtgggaaatccttctgccataagtcagccttcagagtccatagaagaattcacacaggagagaaaccatatgaatgtaatcaatgtgggaaaacctaccgtcgcctgtggactctcactgaacatcagaaaatacacacaggagagaaaccttatgaatgtaacaaatgtgagaaaacatttcgccacaaatcaaactttcttttacatcagaaatcccacaaggaataa
Sequence Length
2043
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
79,649 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 334, mRNA
NCBI Official Synonym Full Names
zinc finger protein 334
NCBI Official Symbol
ZNF334
NCBI Protein Information
zinc finger protein 334
UniProt Protein Name
Zinc finger protein 334
Protein Family
UniProt Gene Name
ZNF334
UniProt Entry Name
ZN334_HUMAN

NCBI Description

This gene encodes a member of the C2H2 zinc finger family. The encoded protein contains a Krueppel-associated box, fourteen C2H2 zinc finger domains, and four C2H2-type/integrase DNA-binding domains. Decreased expression of this gene may be a marker for rheumatoid arthritis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]

Uniprot Description

ZNF334: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 20q13.12

Molecular Function: transcription factor activity

Biological Process: regulation of transcription, DNA-dependent

Research Articles on ZNF334

Similar Products

Product Notes

The ZNF334 znf334 (Catalog #AAA1268158) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaatga aaaaatttca gataccagtt tcattccagg acctgactgt gaacttcacc caagaggaat ggcagcaact ggaccctgct cagaggctcc tgtacaggga tgtgatgctg gagaactaca gcaacttggt ctctgtgggg tatcatgtta gcaaaccaga tgtgattttc aaattggagc aaggagaaga gccatggata gtggaggaat tctcaaatca gaactaccca gacattgatg atgccttaga gaagaacaag gaaatccaag ataaacattt gacacaaact gtattcttca gcaacaaaac actgattaca gaaagagaga atgtatttgg gaaaacactt aatctgggca tgaatagtgt tccctcaaga aaaatgccct ataaatgtaa tccaggagga aacagtttga aaactaattc agaagtaatt gttgcaaaga aaagcaaaga aaacagaaag attcctgatg gatacagtgg atttgggaag catgagaaaa gtcatttggg aatgaaaaaa tacagataca atccaatgag gaaagccagc aatcaaaacg aaaatcttat tctgcaccag aacattcaga ttttgaaaca accgtttgac tataataaat gtgggaaaac cttcttcaag agggcaattc tcattacaca aaaggggaga cagactgaaa ggaaaccaaa tgaatgtaat gaatgtagga aaaccttttc taagagatct accctcattg tacatcagag aattcataca ggggagaaac cgtatgtttg tagtgattgt aggaaaactt ttcgtgtgaa gacaagcctc actcgacacc gaagaattca tactggagag agaccctatg aatgcagtga atgcaggaaa accttcattg acaaatctgc ccttattgta caccagaaaa ttcatggagg ggagaaatcc tatgagtgta atgaatgtgg aaagaccttt tttcggaagt cagccctggc tgaacatttc aggtcacaca caggggagaa gccttacgaa tgcaaggaat gtggaaatgc cttcagcaag aaatcgtatc ttgttgtaca tcaaagaact cacagaggag agaagccaaa tgaatgtaag gaatgtggga aaaccttctt ctgtcagtca gcccttactg cgcatcagag aattcacaca ggggaaaaac cctatgaatg tagtgaatgt gagaaaacct tcttttgtca atctgccctc aatgtgcatc gaagaagtca tacaggagag aagccctatg aatgcagtca atgtggaaaa tttttatgta cgaaatcagc cctcattgca catcagataa ctcatagagg aaagaagtct tatgaatgta atgaatgtgg gaaatttttc tgccataagt caacactcac tatacatcag agaacacaca caggagagaa acatggtgtg tttaataaat gtggtagaat ctccattgtg aagtcaaact gcagtcagtg taagagaatg aacacaaagg agaatcttta tgagtgtagt gaacatgggc atgccgtcag caaaaactca cacctcattg tacatcagag aactatatgg gagagaccat atgaatgcaa tgaatgtggg agaacctact gcaggaagtc agccctgact caccatcaga gaacacacac aggacagaga ccctatgagt gtaatgaatg tgggaaaacc ttctgtcaga agttctcctt tgttgaacat cagcgaactc acactgggga gaaaccatat gaatgtaatg aatgtgggaa atccttctgc cataagtcag ccttcagagt ccatagaaga attcacacag gagagaaacc atatgaatgt aatcaatgtg ggaaaaccta ccgtcgcctg tggactctca ctgaacatca gaaaatacac acaggagaga aaccttatga atgtaacaaa tgtgagaaaa catttcgcca caaatcaaac tttcttttac atcagaaatc ccacaaggaa taa. It is sometimes possible for the material contained within the vial of "ZNF334, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.