DYRK3 cdna clone
DYRK3 cDNA Clone
Gene Names
DYRK3; RED; REDK; DYRK5; hYAK3-2
Synonyms
DYRK3; DYRK3 cDNA Clone; DYRK3 cdna clone
Sequence
atgaagtggaaagagaagttgggggatggtgtctatgacaccttcatgatgatagatgaaaccaaatgtcccccctgttcaaatgtactctgcaatccttctgaaccacctccacccagaagactaaatatgaccactgagcagtttacaggagatcatactcagcactttttggatggaggtgagatgaaggtagaacagctgtttcaagaatttggcaacagaaaatccaatactattcagtcagatggcatcagtgactctgaaaaatgctctcctactgtttctcagggtaaaagttcagattgcttgaatacagtaaaatccaacagttcatccaaggcacccaaagtggtgcctctgactccagaacaagccctgaagcaatataaacaccacctcactgcctatgagaaactggaaataattaattatccagaaatttactttgtaggtccaaatgccaagaaaagacatggagttattggtggtcccaataatggagggtatgatgatgcagatggggcctatattcatgtacctcgagaccatctagcttatcgatatgaggtgctgaaaattattggcaaggggagttttgggcaggtggccagggtctatgatcacaaacttcgacagtacgtggccctaaaaatggtgcgcaatgagaagcgctttcatcgtcaagcagctgaggagatccggattttggagcatcttaagaaacaggataaaactggtagtatgaacgttatccacatgctggaaagtttcacattccggaaccatgtttgcatggcctttgaattgctgagcatagacctttatgagctgattaaaaaaaataagtttcagggttttagcgtccagttggtacacaagtttgcccagtccatcttgcaatctttggatgccctccacaaaaataagattattcactgcgatctgaagccagaaaacattctcctgaaacaccacgggcgcagttcaaccaaggtcattgactttgggtccagctgtttcgagtaccagaagctctacacatatatccagtctcggttctacagagctccagaaatcatcttaggaagccgctacagcacaccaattgacatatggagttttggctgcatccttgcagaacttttaacaggacagcctctcttccctggagaggatgaaggagaccagttggcctgcatgatggagcttctagggatgccaccaccaaaacttctggagcaatccaaacgtgccaagtactttattaattccaagggcataccccgctactgctctgtgactacccaggcagatgggagggttgtgcttgtggggggtcgctcacgtaggggtaaaaagcggggtcccccaggcagcaaagactgggggacagcactgaaagggtgtgatgactacttgtttatagagttcttgaaaaggtgtcttcactgggacccctctgcccgcttgaccccagctcaagcattaagacacccttggattagcaagtctgtccccagacctctcaccaccatagacaaggtgtcagggaaacgggtagttaatcctgcaagtgctttccagggattgggttctaagctgcctccagttgttggaatagccaataagcttaaagctaacttaatgtcagaaaccaatggtagtatacccctatgcagtgtattgccaaaactgattagctag
Sequence Length
1707
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
63,977 Da
NCBI Official Full Name
Homo sapiens dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3, mRNA
NCBI Official Synonym Full Names
dual specificity tyrosine phosphorylation regulated kinase 3
NCBI Official Symbol
DYRK3
NCBI Official Synonym Symbols
RED; REDK; DYRK5; hYAK3-2
NCBI Protein Information
dual specificity tyrosine-phosphorylation-regulated kinase 3
UniProt Protein Name
Dual specificity tyrosine-phosphorylation-regulated kinase 3
Protein Family
UniProt Gene Name
DYRK3
UniProt Synonym Gene Names
REDK
UniProt Entry Name
DYRK3_HUMAN
NCBI Description
This gene product belongs to the DYRK family of dual-specificity protein kinases that catalyze autophosphorylation on serine/threonine and tyrosine residues. The members of this family share structural similarity, however, differ in their substrate specificity, suggesting their involvement in different cellular functions. The encoded protein has been shown to autophosphorylate on tyrosine residue and catalyze phosphorylation of histones H3 and H2B in vitro. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Uniprot Description
DYRK3: a dual-specificity protein kinase of the DYRK family. Localizes in the cytoplasm. Expressed primarily in erythroid progenitor cells and regulates late erythropoiesis.
Protein type: EC 2.7.12.1; Protein kinase, dual-specificity (non-receptor); Protein kinase, CMGC; Kinase, protein; CMGC group; DYRK family; Dyrk2 subfamily
Chromosomal Location of Human Ortholog: 1q32.1
Cellular Component: nucleus
Molecular Function: ATP binding; magnesium ion binding; protein kinase activity
Biological Process: erythrocyte differentiation; protein amino acid phosphorylation
Research Articles on DYRK3
Similar Products
Product Notes
The DYRK3 dyrk3 (Catalog #AAA1268080) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtgga aagagaagtt gggggatggt gtctatgaca ccttcatgat gatagatgaa accaaatgtc ccccctgttc aaatgtactc tgcaatcctt ctgaaccacc tccacccaga agactaaata tgaccactga gcagtttaca ggagatcata ctcagcactt tttggatgga ggtgagatga aggtagaaca gctgtttcaa gaatttggca acagaaaatc caatactatt cagtcagatg gcatcagtga ctctgaaaaa tgctctccta ctgtttctca gggtaaaagt tcagattgct tgaatacagt aaaatccaac agttcatcca aggcacccaa agtggtgcct ctgactccag aacaagccct gaagcaatat aaacaccacc tcactgccta tgagaaactg gaaataatta attatccaga aatttacttt gtaggtccaa atgccaagaa aagacatgga gttattggtg gtcccaataa tggagggtat gatgatgcag atggggccta tattcatgta cctcgagacc atctagctta tcgatatgag gtgctgaaaa ttattggcaa ggggagtttt gggcaggtgg ccagggtcta tgatcacaaa cttcgacagt acgtggccct aaaaatggtg cgcaatgaga agcgctttca tcgtcaagca gctgaggaga tccggatttt ggagcatctt aagaaacagg ataaaactgg tagtatgaac gttatccaca tgctggaaag tttcacattc cggaaccatg tttgcatggc ctttgaattg ctgagcatag acctttatga gctgattaaa aaaaataagt ttcagggttt tagcgtccag ttggtacaca agtttgccca gtccatcttg caatctttgg atgccctcca caaaaataag attattcact gcgatctgaa gccagaaaac attctcctga aacaccacgg gcgcagttca accaaggtca ttgactttgg gtccagctgt ttcgagtacc agaagctcta cacatatatc cagtctcggt tctacagagc tccagaaatc atcttaggaa gccgctacag cacaccaatt gacatatgga gttttggctg catccttgca gaacttttaa caggacagcc tctcttccct ggagaggatg aaggagacca gttggcctgc atgatggagc ttctagggat gccaccacca aaacttctgg agcaatccaa acgtgccaag tactttatta attccaaggg cataccccgc tactgctctg tgactaccca ggcagatggg agggttgtgc ttgtgggggg tcgctcacgt aggggtaaaa agcggggtcc cccaggcagc aaagactggg ggacagcact gaaagggtgt gatgactact tgtttataga gttcttgaaa aggtgtcttc actgggaccc ctctgcccgc ttgaccccag ctcaagcatt aagacaccct tggattagca agtctgtccc cagacctctc accaccatag acaaggtgtc agggaaacgg gtagttaatc ctgcaagtgc tttccaggga ttgggttcta agctgcctcc agttgttgga atagccaata agcttaaagc taacttaatg tcagaaacca atggtagtat acccctatgc agtgtattgc caaaactgat tagctag. It is sometimes possible for the material contained within the vial of "DYRK3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
