PGBD2 cdna clone
PGBD2 cDNA Clone
Synonyms
PGBD2; PGBD2 cDNA Clone; PGBD2 cdna clone
Sequence
atggcttcaacatccagagatgtcattgctgggagaggtatccactcaaaggtgaagtctgcaaagctgcttgaggttctgaatgctatggaggaggaagagtccaacaacaacagggaagagattttcattgcacctcccgacaatgctgcgggggaattcactgatgaggactcaggggatgaagacagccagcgaggtgctcacctacctggcagtgtgctgcatgcttcagtcctgtgtgaggactctggcaccggggaggataatgacgacctggagctgcagccagccaagaagaggcagaaagcagttgtgaaacctcagcgcatttggaccaaaagagatattcgtccagactttggcagttggactgcatcagatcctcatattgaggatctgaaaagccaagagctgagtcccgtgggcctttttgagttgttttttgatgaaggaacaattaatttcattgttaatgaaaccaatcgttatgcttggcagaaaaatgtcaatttgagtcttacggctcaggaattgaagtgtgttttgggcattttgattttaagtgggtacatctcttatccaaggagaaggatgttctgggaaacctctcccgattcacatcatcatcttgtggctgatgcaattagaagggacagatttgaactaatcttctcatacttacattttgcagataacaacgaacttgatgcaagtgataggtttgccaaggtcagacctctcatcatccggatgaactgcaatttccagaagcatgcacccttggaagagttctacagctttggcgagtctatgtgtgagtactttgggcaccgggggtccaagcagctgcacagggggaagcctgtgcgacttggctacaagatttggtgtgggacaaccagcagaggctacttggtgtggtttgagccctcacagggcacactgtttaccaagccagacaggagcttggatctaggaggcagtatggtaataaaatttgtggatgcgcttcaggagcgtggttttctgccatatcacatattttttgacaaggttttcacaagtgttaaactgatgtccattttgaggaaaaagggggtgaaagccacaggaactgttcgtgagtacaggactgagcgatgtcccctaaaagaccccaaagaactgaaaaaaatgaagaggggttcatttgattacaaagtcgatgagagtgaggagatcatcgtgtgccgctggcacgatagcagcgtggtcaacatttgctccaatgctgtgggcatagagccagtgaggctgaccagtcgtcactctggagcagctaaaacgcggactcaggtccaccagccatcactggtgaagctgtatcaggagaaggtgggtggcgttggtaggatggatcagaatattgccaagtacaaggtgaagatccgaggcatgaagtggtactcaagctttattggctatgtcattgatgctgccctcaacaatgcatggcagctgcatagaatctgctgccaagatgcccaggtggacctccttgccttccggagatacattgcctgtgtgtatctggagagcaatgctgacacaacatctcaagggaggcgaagcaggcggttggagactgagagccgcttcgatatgattgggcactggattatccatcaggacaagaggacccggtgtgccctctgccactcacagaccaacacccggtgtgagaagtgccagaagggtgtccatgccaaatgcttcagggagtaccacatccggtga
Sequence Length
1779
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,563 Da
NCBI Official Full Name
Homo sapiens piggyBac transposable element derived 2, mRNA
NCBI Official Synonym Full Names
piggyBac transposable element derived 2
NCBI Official Symbol
PGBD2
NCBI Protein Information
piggyBac transposable element-derived protein 2
UniProt Protein Name
PiggyBac transposable element-derived protein 2
Protein Family
UniProt Gene Name
PGBD2
UniProt Entry Name
PGBD2_HUMAN
NCBI Description
The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. The exact function of this gene is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
PGBD2: 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 1q44
Similar Products
Product Notes
The PGBD2 pgbd2 (Catalog #AAA1268001) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcaa catccagaga tgtcattgct gggagaggta tccactcaaa ggtgaagtct gcaaagctgc ttgaggttct gaatgctatg gaggaggaag agtccaacaa caacagggaa gagattttca ttgcacctcc cgacaatgct gcgggggaat tcactgatga ggactcaggg gatgaagaca gccagcgagg tgctcaccta cctggcagtg tgctgcatgc ttcagtcctg tgtgaggact ctggcaccgg ggaggataat gacgacctgg agctgcagcc agccaagaag aggcagaaag cagttgtgaa acctcagcgc atttggacca aaagagatat tcgtccagac tttggcagtt ggactgcatc agatcctcat attgaggatc tgaaaagcca agagctgagt cccgtgggcc tttttgagtt gttttttgat gaaggaacaa ttaatttcat tgttaatgaa accaatcgtt atgcttggca gaaaaatgtc aatttgagtc ttacggctca ggaattgaag tgtgttttgg gcattttgat tttaagtggg tacatctctt atccaaggag aaggatgttc tgggaaacct ctcccgattc acatcatcat cttgtggctg atgcaattag aagggacaga tttgaactaa tcttctcata cttacatttt gcagataaca acgaacttga tgcaagtgat aggtttgcca aggtcagacc tctcatcatc cggatgaact gcaatttcca gaagcatgca cccttggaag agttctacag ctttggcgag tctatgtgtg agtactttgg gcaccggggg tccaagcagc tgcacagggg gaagcctgtg cgacttggct acaagatttg gtgtgggaca accagcagag gctacttggt gtggtttgag ccctcacagg gcacactgtt taccaagcca gacaggagct tggatctagg aggcagtatg gtaataaaat ttgtggatgc gcttcaggag cgtggttttc tgccatatca catatttttt gacaaggttt tcacaagtgt taaactgatg tccattttga ggaaaaaggg ggtgaaagcc acaggaactg ttcgtgagta caggactgag cgatgtcccc taaaagaccc caaagaactg aaaaaaatga agaggggttc atttgattac aaagtcgatg agagtgagga gatcatcgtg tgccgctggc acgatagcag cgtggtcaac atttgctcca atgctgtggg catagagcca gtgaggctga ccagtcgtca ctctggagca gctaaaacgc ggactcaggt ccaccagcca tcactggtga agctgtatca ggagaaggtg ggtggcgttg gtaggatgga tcagaatatt gccaagtaca aggtgaagat ccgaggcatg aagtggtact caagctttat tggctatgtc attgatgctg ccctcaacaa tgcatggcag ctgcatagaa tctgctgcca agatgcccag gtggacctcc ttgccttccg gagatacatt gcctgtgtgt atctggagag caatgctgac acaacatctc aagggaggcg aagcaggcgg ttggagactg agagccgctt cgatatgatt gggcactgga ttatccatca ggacaagagg acccggtgtg ccctctgcca ctcacagacc aacacccggt gtgagaagtg ccagaagggt gtccatgcca aatgcttcag ggagtaccac atccggtga. It is sometimes possible for the material contained within the vial of "PGBD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
