Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IFI16 cdna clone

IFI16 cDNA Clone

Gene Names
IFI16; PYHIN2; IFNGIP1
Synonyms
IFI16; IFI16 cDNA Clone; IFI16 cdna clone
Ordering
For Research Use Only!
Sequence
atgggaaaaaaatacaagaacattgttctactaaaaggattagaggtcatcaatgattatcattttagaatggttaagtccttactgagcaacgatttaaaacttaatttaaaaatgagagaagagtatgacaaaattcagattgctgacttgatggaagaaaagttccgaggtgatgctggtttgggcaaactaataaaaattttcgaagatataccaacgcttgaagacctggctgaaactcttaaaaaagaaaagttaaaagtaaaaggaccagccctatcaagaaagaggaagaaggaagtggatgctacttcacctgcaccctccacaagcagcactgtcaaaactgaaggagcagaggcaactcctggagctcagaaaagaaaaaaatcaaccaaagaaaaggctggacccaaagggagtaaggtgtccgaggaacagactcagcctccctctcctgcaggagccggcatgtccacagccatgggccgttccccatctcccaagacctcattgtcagctccacccaacacttcttcaactgagaacccgaaaacagtggccaaatgtcaggtaactcccagaagaaatgttctccaaaaacgcccagtgatagtgaaggtactgagtacaacaaagccatttgaatatgagaccccagaaatggagaaaaaaataatgtttcatgctacagtggctacacagacacagttcttccatgtgaaggttttaaacaccagcttgaaggagaaattcaatggaaagaaaatcatcatcatatcagattatttggaatatgatagtctcctagaggtcaatgaagaatctactgtatctgaagctggtcctaaccaaacgtttgaggttccaaataaaatcatcaacagagcaaaggaaactctgaagattgatattcttcacaaacaagcttcaggaaatattgtatatggggtatttatgctacataagaaaacagtaaatcagaagaccacaatctacgaaattcaggatgatagaggaaaaatggatgtagtggggacaggacaatgtcacaatatcccctgtgaagaaggagataagctccaacttttctgctttcgacttagaaaaaagaaccagatgtcaaaactgatttcagaaatgcatagttttatccagataaagaaaaaaacaaacccgagaaacaatgaccccaagagcatgaagctaccccaggaacagagtcagcttccaaatccttcagaggccagcacaaccttccctgagagccatcttcggactcctcagatgccaccaacaactccatccagcagtttcttcaccaagaaaagtgaagacacaatctccaaaatgaatgacttcatgaggatgcagatactgaaggaagggagtcattttccaggaccgttcatgaccagcataggcccagctgagagccatccccacactcctcagatgcctccatcaacaccaagcagcagtttcttaaccacgttgaaaccaagactgaagactgaacctgaagaagtttccatagaagacagtgcccagagtgacctcaaagaagtgatggtgctgaacgcaacagaatcatttgtatatgagcccaaagagcagaagaaaatgtttcatgccacagtggcaactgagaatgaagtcttccgagtgaaggtttttaatattgacctaaaggagaagttcaccccaaagaagatcattgccatagcaaattatgtttgccgcaatgggttcctggaggtatatcctttcacacttgtggctgatgtgaatgctgaccgaaacatggagatcccaaaaggattgattagaagtgccagcgtaactcctaaaatcaatcagctttgctcacaaactaaaggaagttttgtgaatggggtgtttgaggtacataagaaaaatgtaaggggtgaattcacttattatgaaatacaagataatacagggaagatggaagtggtggtgcatggacgactgaccacaatcaactgtgaggaaggagataaactgaaactcacctgctttgaattggcaccgaaaagtgggaataccggggagttgagatctgtaattcatagtcacatcaaggtcatcaagaccaggaaaaacaagaaagacatactcaatcctgattcaagtatggaaacttcaccagactttttcttctaa
Sequence Length
2190
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
82,588 Da
NCBI Official Full Name
Homo sapiens interferon, gamma-inducible protein 16, mRNA
NCBI Official Synonym Full Names
interferon gamma inducible protein 16
NCBI Official Symbol
IFI16
NCBI Official Synonym Symbols
PYHIN2; IFNGIP1
NCBI Protein Information
gamma-interferon-inducible protein 16
UniProt Protein Name
Gamma-interferon-inducible protein 16
UniProt Gene Name
IFI16
UniProt Synonym Gene Names
IFNGIP1; Ifi-16
UniProt Entry Name
IF16_HUMAN

NCBI Description

This gene encodes a member of the HIN-200 (hematopoietic interferon-inducible nuclear antigens with 200 amino acid repeats) family of cytokines. The encoded protein contains domains involved in DNA binding, transcriptional regulation, and protein-protein interactions. The protein localizes to the nucleoplasm and nucleoli, and interacts with p53 and retinoblastoma-1. It modulates p53 function, and inhibits cell growth in the Ras/Raf signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]

Uniprot Description

IFI16: a nuclear protein that may function as a transcriptional repressor. Strongly induced by gamma interferon and, to a lesser extent, by alpha interferon. Binds double-stranded DNA and cell cycle regulatory factors including p53 and Rb. Loss of IFI16 activates p53 checkpoint through NBS1-DNAPK pathway. Inhibits cell growth in the Ras/Raf signaling pathway. May be involved in the senescence of prostate epithelial cells. Expressed in peripheral blood leukocytes, fibroblasts and lymphoid cells. Present in myeloid precursors (CD34+) and throughout monocyte development, but its expression is down-regulated in erythroid and polymorphonuclear precursor cells. Present in prostate, ovary and breast. Four alternatively spliced isoforms have been described. Isoforms-1, -2 and -3 can homo- and hetero-dimerize.

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: 1q22

Cellular Component: cytoplasm; cytosol; membrane; nuclear speck; nucleolus; nucleoplasm; nucleus

Molecular Function: double-stranded DNA binding; protein binding; transcription factor binding

Biological Process: activation of innate immune response; cellular response to glucose starvation; defense response to virus; DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis; monocyte differentiation; negative regulation of DNA binding; negative regulation of innate immune response; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; negative regulation of viral genome replication; positive regulation of cytokine production; positive regulation of interferon type I production; positive regulation of interleukin-1 beta production; positive regulation of transcription from RNA polymerase II promoter; regulation of autophagy; regulation of gene expression, epigenetic

Research Articles on IFI16

Similar Products

Product Notes

The IFI16 ifi16 (Catalog #AAA1267956) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaaaaa aatacaagaa cattgttcta ctaaaaggat tagaggtcat caatgattat cattttagaa tggttaagtc cttactgagc aacgatttaa aacttaattt aaaaatgaga gaagagtatg acaaaattca gattgctgac ttgatggaag aaaagttccg aggtgatgct ggtttgggca aactaataaa aattttcgaa gatataccaa cgcttgaaga cctggctgaa actcttaaaa aagaaaagtt aaaagtaaaa ggaccagccc tatcaagaaa gaggaagaag gaagtggatg ctacttcacc tgcaccctcc acaagcagca ctgtcaaaac tgaaggagca gaggcaactc ctggagctca gaaaagaaaa aaatcaacca aagaaaaggc tggacccaaa gggagtaagg tgtccgagga acagactcag cctccctctc ctgcaggagc cggcatgtcc acagccatgg gccgttcccc atctcccaag acctcattgt cagctccacc caacacttct tcaactgaga acccgaaaac agtggccaaa tgtcaggtaa ctcccagaag aaatgttctc caaaaacgcc cagtgatagt gaaggtactg agtacaacaa agccatttga atatgagacc ccagaaatgg agaaaaaaat aatgtttcat gctacagtgg ctacacagac acagttcttc catgtgaagg ttttaaacac cagcttgaag gagaaattca atggaaagaa aatcatcatc atatcagatt atttggaata tgatagtctc ctagaggtca atgaagaatc tactgtatct gaagctggtc ctaaccaaac gtttgaggtt ccaaataaaa tcatcaacag agcaaaggaa actctgaaga ttgatattct tcacaaacaa gcttcaggaa atattgtata tggggtattt atgctacata agaaaacagt aaatcagaag accacaatct acgaaattca ggatgataga ggaaaaatgg atgtagtggg gacaggacaa tgtcacaata tcccctgtga agaaggagat aagctccaac ttttctgctt tcgacttaga aaaaagaacc agatgtcaaa actgatttca gaaatgcata gttttatcca gataaagaaa aaaacaaacc cgagaaacaa tgaccccaag agcatgaagc taccccagga acagagtcag cttccaaatc cttcagaggc cagcacaacc ttccctgaga gccatcttcg gactcctcag atgccaccaa caactccatc cagcagtttc ttcaccaaga aaagtgaaga cacaatctcc aaaatgaatg acttcatgag gatgcagata ctgaaggaag ggagtcattt tccaggaccg ttcatgacca gcataggccc agctgagagc catccccaca ctcctcagat gcctccatca acaccaagca gcagtttctt aaccacgttg aaaccaagac tgaagactga acctgaagaa gtttccatag aagacagtgc ccagagtgac ctcaaagaag tgatggtgct gaacgcaaca gaatcatttg tatatgagcc caaagagcag aagaaaatgt ttcatgccac agtggcaact gagaatgaag tcttccgagt gaaggttttt aatattgacc taaaggagaa gttcacccca aagaagatca ttgccatagc aaattatgtt tgccgcaatg ggttcctgga ggtatatcct ttcacacttg tggctgatgt gaatgctgac cgaaacatgg agatcccaaa aggattgatt agaagtgcca gcgtaactcc taaaatcaat cagctttgct cacaaactaa aggaagtttt gtgaatgggg tgtttgaggt acataagaaa aatgtaaggg gtgaattcac ttattatgaa atacaagata atacagggaa gatggaagtg gtggtgcatg gacgactgac cacaatcaac tgtgaggaag gagataaact gaaactcacc tgctttgaat tggcaccgaa aagtgggaat accggggagt tgagatctgt aattcatagt cacatcaagg tcatcaagac caggaaaaac aagaaagaca tactcaatcc tgattcaagt atggaaactt caccagactt tttcttctaa. It is sometimes possible for the material contained within the vial of "IFI16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.