Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SFRP2 cdna clone

SFRP2 cDNA Clone

Gene Names
SFRP2; FRP-2; SARP1; SDF-5
Synonyms
SFRP2; SFRP2 cDNA Clone; SFRP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcagggccctggctcgctgctgctgctcttcctcgcctcgcactgctgcctgggctcggcgcgcgggctcttcctctttggccagcccgacttctcctacaagcgcagcaattgcaagcccatcccggtcaacctgcagctgtgccacggcatcgaataccagaacatgcggctgcccaacctgctgggccacgagaccatgaaggaggtgctggagcaggccggcgcttggatcccgctggtcatgaagcagtgccacccggacaccaagaagttcctgtgctcgctcttcgcccccgtctgcctcgatgacctagacgagaccatccagccatgccactcgctctgcgtgcaggtgaaggaccgctgcgccccggtcatgtccgccttcggcttcccctggcccgacatgcttgagtgcgaccgtttcccccaggacaacgacctttgcatccccctcgctagcagcgaccacctcctgccagccaccgaggaagctccaaaggtatgtgaagcctgcaaaaataaaaatgatgatgacaacgacataatggaaacgctttgtaaaaatgattttgcactgaaaataaaagtgaaggagataacctacatcaaccgagataccaaaatcatcctggagaccaagagcaagaccatttacaagctgaacggtgtgtccgaaagggacctgaagaaatcggtgctgtggctcaaagacagcttgcagtgcacctgtgaggagatgaacgacatcaacgcgccctatctggtcatgggacagaaacagggtggggagctggtgatcacctcggtgaagcggtggcagaaggggcagagagagttcaagcgcatctcccgcagcatccgcaagctgcagtgctag
Sequence Length
888
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,490 Da
NCBI Official Full Name
Homo sapiens secreted frizzled-related protein 2, mRNA
NCBI Official Synonym Full Names
secreted frizzled related protein 2
NCBI Official Symbol
SFRP2
NCBI Official Synonym Symbols
FRP-2; SARP1; SDF-5
NCBI Protein Information
secreted frizzled-related protein 2
UniProt Protein Name
Secreted frizzled-related protein 2
UniProt Gene Name
SFRP2
UniProt Synonym Gene Names
FRP2; SARP1; FRP-2; sFRP-2; SARP-1
UniProt Entry Name
SFRP2_HUMAN

NCBI Description

This gene encodes a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. Methylation of this gene is a potential marker for the presence of colorectal cancer. [provided by RefSeq, Jul 2008]

Uniprot Description

SFRP2: Soluble frizzled-related proteins (sFRPS) function as modulators of Wnt signaling through direct interaction with Wnts. They have a role in regulating cell growth and differentiation in specific cell types. SFRP2 may be important for eye retinal development and for myogenesis. Belongs to the secreted frizzled-related protein (sFRP) family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 4q31.3

Cellular Component: extracellular matrix; extracellular space; integral to membrane

Molecular Function: fibronectin binding; G-protein coupled receptor activity; integrin binding; receptor agonist activity; Wnt receptor activity; Wnt-protein binding

Biological Process: cell-cell signaling; negative regulation of cell growth; negative regulation of cell migration; negative regulation of cell proliferation; negative regulation of epithelial cell proliferation; negative regulation of peptidyl-tyrosine phosphorylation; negative regulation of transcription, DNA-dependent; negative regulation of Wnt receptor signaling pathway; patterning of blood vessels; positive regulation of angiogenesis; positive regulation of apoptosis; positive regulation of cell adhesion mediated by integrin; positive regulation of cell growth; positive regulation of cell proliferation; positive regulation of fat cell differentiation; positive regulation of peptidyl-serine phosphorylation; positive regulation of transcription from RNA polymerase II promoter

Research Articles on SFRP2

Similar Products

Product Notes

The SFRP2 sfrp2 (Catalog #AAA1267890) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcagg gccctggctc gctgctgctg ctcttcctcg cctcgcactg ctgcctgggc tcggcgcgcg ggctcttcct ctttggccag cccgacttct cctacaagcg cagcaattgc aagcccatcc cggtcaacct gcagctgtgc cacggcatcg aataccagaa catgcggctg cccaacctgc tgggccacga gaccatgaag gaggtgctgg agcaggccgg cgcttggatc ccgctggtca tgaagcagtg ccacccggac accaagaagt tcctgtgctc gctcttcgcc cccgtctgcc tcgatgacct agacgagacc atccagccat gccactcgct ctgcgtgcag gtgaaggacc gctgcgcccc ggtcatgtcc gccttcggct tcccctggcc cgacatgctt gagtgcgacc gtttccccca ggacaacgac ctttgcatcc ccctcgctag cagcgaccac ctcctgccag ccaccgagga agctccaaag gtatgtgaag cctgcaaaaa taaaaatgat gatgacaacg acataatgga aacgctttgt aaaaatgatt ttgcactgaa aataaaagtg aaggagataa cctacatcaa ccgagatacc aaaatcatcc tggagaccaa gagcaagacc atttacaagc tgaacggtgt gtccgaaagg gacctgaaga aatcggtgct gtggctcaaa gacagcttgc agtgcacctg tgaggagatg aacgacatca acgcgcccta tctggtcatg ggacagaaac agggtgggga gctggtgatc acctcggtga agcggtggca gaaggggcag agagagttca agcgcatctc ccgcagcatc cgcaagctgc agtgctag. It is sometimes possible for the material contained within the vial of "SFRP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.