IZUMO1 cdna clone

IZUMO1 cDNA Clone

Gene Names

IZUMO1; OBF; IZUMO

Synonyms

IZUMO1; IZUMO1 cDNA Clone; IZUMO1 cdna clone

Ordering
Cat. Num. AAA1267852 For Research Use Only!

Sequence

atggggccgcattttaccctcctgtgtgcggcgctggccggttgcttgcttcctgccgaggggtgtgttatatgtgacccgtctgtcgtgctggcgctaaagtccctggagaaagattacctgcctggccacctggatgcgaagcatcacaaagccatgatggaaagggtagagaatgccgtgaaggatttccaggaactgtcgcttaatgaggatgcctatatgggggtcgttgatgaggccacactgcaaaaggggtcctggagtttgctgaaggatctgaaacgcatcacagacagtgatgtaaaaggcgatctctttgtgaaggagctattttggatgttgcacttgcaaaaggaaacctttgccacctatgttgctcgattccaaaaagaggcttattgtcccaacaaatgtggtgtgatgttgcaaactctgatctggtgcaagaactgcaaaaaggaggttcacgcttgtcgaaagtcctacgattgcggggagcggaatgtggaagttcctcaaatggaagacatgatcctggactgtgagttaaactggcatcaggcttcggaaggcctcactgattacagcttttacagggtttgggggaacaatacggagaccttggtgtccaaggggaaagaggccaccctgaccaagcccatggtgggtccagaggatgcaggcagctaccgctgcgagctgggctctgtgaattccagcccagccacgatcatcaattttcacgtcacagtgttgcccaaaatgatcaaggaggaaaaaccttctccaaatatcgtaaccccgggggaggcgaccacggagtcgtccataagcctccagcctctgcagcccgagaaaatgctggcaagccgccttctggggctgctgatctgcggctccctagcactgataaccggccttacctttgcgatatttcgtcgaaggaaggtgatcgatttcatcaaatcctcactgtttggccttggcagtggagttgccgagcaaacccaggtcccaaaagaaaaggccacagattcgaggcaacaataa

Sequence Length

1053

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

22902471

NCBI GeneID

284359

Molecular Weight

7,339 Da

NCBI Official Full Name

Homo sapiens izumo sperm-egg fusion 1, mRNA

NCBI Official Synonym Full Names

izumo sperm-egg fusion 1

NCBI Official Symbol

IZUMO1

NCBI Official Synonym Symbols

OBF; IZUMO

NCBI Protein Information

izumo sperm-egg fusion protein 1

UniProt Protein Name

Izumo sperm-egg fusion protein 1

Protein Family

Izumo sperm-egg fusion protein

UniProt Gene Name

IZUMO1

UniProt Synonym Gene Names

OBF

UniProt Entry Name

IZUM1_HUMAN

NCBI Description

The sperm-specific protein Izumo, named for a Japanese shrine dedicated to marriage, is essential for sperm-egg plasma membrane binding and fusion (Inoue et al., 2005 [PubMed 15759005]).[supplied by OMIM, Mar 2008]

Uniprot Description

IZUMO1: Involved in the fertilization process. May be involved in the fusion of the sperm with the egg. Belongs to the Izumo family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 19q13.33

Cellular Component: integral to membrane; plasma membrane

Molecular Function: protein homodimerization activity; receptor binding

Biological Process: cell adhesion; fusion of sperm to egg plasma membrane; single fertilization; sperm-egg recognition

Research Articles on IZUMO1

1. crystal structures of human IZUMO1 and JUNO in unbound and bound conformations

Similar Products

Product Notes

The IZUMO1 izumo1 (Catalog #AAA1267852) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggccgc attttaccct cctgtgtgcg gcgctggccg gttgcttgct tcctgccgag gggtgtgtta tatgtgaccc gtctgtcgtg ctggcgctaa agtccctgga gaaagattac ctgcctggcc acctggatgc gaagcatcac aaagccatga tggaaagggt agagaatgcc gtgaaggatt tccaggaact gtcgcttaat gaggatgcct atatgggggt cgttgatgag gccacactgc aaaaggggtc ctggagtttg ctgaaggatc tgaaacgcat cacagacagt gatgtaaaag gcgatctctt tgtgaaggag ctattttgga tgttgcactt gcaaaaggaa acctttgcca cctatgttgc tcgattccaa aaagaggctt attgtcccaa caaatgtggt gtgatgttgc aaactctgat ctggtgcaag aactgcaaaa aggaggttca cgcttgtcga aagtcctacg attgcgggga gcggaatgtg gaagttcctc aaatggaaga catgatcctg gactgtgagt taaactggca tcaggcttcg gaaggcctca ctgattacag cttttacagg gtttggggga acaatacgga gaccttggtg tccaagggga aagaggccac cctgaccaag cccatggtgg gtccagagga tgcaggcagc taccgctgcg agctgggctc tgtgaattcc agcccagcca cgatcatcaa ttttcacgtc acagtgttgc ccaaaatgat caaggaggaa aaaccttctc caaatatcgt aaccccgggg gaggcgacca cggagtcgtc cataagcctc cagcctctgc agcccgagaa aatgctggca agccgccttc tggggctgct gatctgcggc tccctagcac tgataaccgg ccttaccttt gcgatatttc gtcgaaggaa ggtgatcgat ttcatcaaat cctcactgtt tggccttggc agtggagttg ccgagcaaac ccaggtccca aaagaaaagg ccacagattc gaggcaacaa taa. It is sometimes possible for the material contained within the vial of "IZUMO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

IZUMO1 cdna clone