Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINF1 cdna clone

SERPINF1 cDNA Clone

Gene Names
SERPINF1; OI6; OI12; PEDF; EPC-1; PIG35
Synonyms
SERPINF1; SERPINF1 cDNA Clone; SERPINF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggccctggtgctactcctctgcattggagccctcctcgggcacagcagctgccagaaccctgccagccccccggaggagggctccccagaccccgacagcacaggggcgctggtggaggaggaggatcctttcttcaaagtccccgtgaacaagctggcagcggctgtctccaacttcggctatgacctgtaccgggtgcgatccagcatgagccccacgaccaacgtgctcctgtctcctctcagtgtggccacggccctctcggccctctcgctgggagcggagcagcgaacagaatccatcattcaccgggctctctactatgacttgatcagcagcccagacatccatggtacctataaggagctccttgacacggtcactgcccgccagaagaacctcaagagtgcctcccggatcgtctttgagaagaagctgcgcataaaatccagctttgtggcacctctggaaaagtcatatgggaccaggcccagagtcctgacgggcaaccctcgcttggacctgcaagagatcaacaactgggtgcaggcgcagatgaaagggaagctcgccaggtccacaaaggaaattcccgatgagatcagcattctccttctcggtgtggcgcacttcaaggggcagtgggtaacaaagtttgactccagaaagacttccctcgaggatttctacttggatgaagagaggaccgtgagggtccccatgatgtcggaccctaaggctgttttacgctatggcttggattcagatctcagctgcaagattgcccagctgcccttgaccggaagcatgagtatcatcttcttcctgcccctgaaagtgacccagaatttgaccttgatagaggagagcctcacctccgagttcattcatgacatagaccgagaactgaagaccgtgcaggcggtcctcactgtccccaagctgaagctgagttacgaaggcgaagtcaccaagtccctgcaggagatgaagctgcaatccttgtttgattcaccagactttagcaagatcacaggcaaacccatcaagctgactcaggtggaacaccgggctggctttgagtggaacgaggatggggcgggaaccacccccagcccagggctgcagcctgcccacctcaccttcccgctggactatcaccttaaccagcctttcatcttcgtactgagggacacagacacaggggcccttctcttcattggcaagattctggaccccaggggcccctaa
Sequence Length
1257
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,312 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1, mRNA
NCBI Official Synonym Full Names
serpin family F member 1
NCBI Official Symbol
SERPINF1
NCBI Official Synonym Symbols
OI6; OI12; PEDF; EPC-1; PIG35
NCBI Protein Information
pigment epithelium-derived factor
UniProt Protein Name
Pigment epithelium-derived factor
UniProt Gene Name
SERPINF1
UniProt Synonym Gene Names
PEDF; PEDF
UniProt Entry Name
PEDF_HUMAN

NCBI Description

This gene encodes a member of the serpin family that does not display the serine protease inhibitory activity shown by many of the other serpin proteins. The encoded protein is secreted and strongly inhibits angiogenesis. In addition, this protein is a neurotrophic factor involved in neuronal differentiation in retinoblastoma cells. Mutations in this gene were found in individuals with osteogenesis imperfecta, type VI. [provided by RefSeq, Aug 2016]

Uniprot Description

PEDF: a secreted neurotrophic protein that induces extensive neuronal differentiation in retinoblastoma cells. Potent inhibitor of angiogenesis. As it does not undergo the S (stressed) to R (relaxed) conformational transition characteristic of active serpins, it exhibits no serine protease inhibitory activity. The N-terminal (AA 44-121) exhibits neurite outgrowth-inducing activity. The C-terminal exposed loop (AA 382-418) is essential for serpin activity. Extracellular phosphorylation enhances antiangiogenic activity.

Protein type: Secreted; Inhibitor; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 17p13.3

Cellular Component: extracellular matrix; extracellular region; extracellular space

Molecular Function: protein binding; serine-type endopeptidase inhibitor activity

Biological Process: cell proliferation; multicellular organismal development; negative regulation of angiogenesis; positive regulation of neurogenesis

Disease: Osteogenesis Imperfecta, Type Vi

Research Articles on SERPINF1

Similar Products

Product Notes

The SERPINF1 serpinf1 (Catalog #AAA1267827) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggccc tggtgctact cctctgcatt ggagccctcc tcgggcacag cagctgccag aaccctgcca gccccccgga ggagggctcc ccagaccccg acagcacagg ggcgctggtg gaggaggagg atcctttctt caaagtcccc gtgaacaagc tggcagcggc tgtctccaac ttcggctatg acctgtaccg ggtgcgatcc agcatgagcc ccacgaccaa cgtgctcctg tctcctctca gtgtggccac ggccctctcg gccctctcgc tgggagcgga gcagcgaaca gaatccatca ttcaccgggc tctctactat gacttgatca gcagcccaga catccatggt acctataagg agctccttga cacggtcact gcccgccaga agaacctcaa gagtgcctcc cggatcgtct ttgagaagaa gctgcgcata aaatccagct ttgtggcacc tctggaaaag tcatatggga ccaggcccag agtcctgacg ggcaaccctc gcttggacct gcaagagatc aacaactggg tgcaggcgca gatgaaaggg aagctcgcca ggtccacaaa ggaaattccc gatgagatca gcattctcct tctcggtgtg gcgcacttca aggggcagtg ggtaacaaag tttgactcca gaaagacttc cctcgaggat ttctacttgg atgaagagag gaccgtgagg gtccccatga tgtcggaccc taaggctgtt ttacgctatg gcttggattc agatctcagc tgcaagattg cccagctgcc cttgaccgga agcatgagta tcatcttctt cctgcccctg aaagtgaccc agaatttgac cttgatagag gagagcctca cctccgagtt cattcatgac atagaccgag aactgaagac cgtgcaggcg gtcctcactg tccccaagct gaagctgagt tacgaaggcg aagtcaccaa gtccctgcag gagatgaagc tgcaatcctt gtttgattca ccagacttta gcaagatcac aggcaaaccc atcaagctga ctcaggtgga acaccgggct ggctttgagt ggaacgagga tggggcggga accaccccca gcccagggct gcagcctgcc cacctcacct tcccgctgga ctatcacctt aaccagcctt tcatcttcgt actgagggac acagacacag gggcccttct cttcattggc aagattctgg accccagggg cccctaa. It is sometimes possible for the material contained within the vial of "SERPINF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.